View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5953_low_24 (Length: 251)
Name: NF5953_low_24
Description: NF5953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5953_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 39366439 - 39366198
Alignment:
| Q |
1 |
ctttggagttgtatgatccatcgattaagatgatcaatttgtatgtcttctcttcgggagaagtgttcatttctgctacgaaatctataagcatatgcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39366439 |
ctttggagttgtatgatccatcgattaagatgatcaatttgtatgtcttctcttcgggagaagtgttcatttgtgctacgaaatctataagcatatgcat |
39366340 |
T |
|
| Q |
101 |
tgttagtgccttcttaggttcaaacttgatgtaaagctcaaataacttcaagaactatttcatc---------atcacatctcatcgaaaaaggattttc |
191 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39366339 |
tgttagtgccttcttagcttcaaacttgatgtaaagctcaaataacttcaagaactatttcatcatttggcttatcacatctcatcgaaaaaggattttc |
39366240 |
T |
|
| Q |
192 |
cttatcagttggtctattcacactatgattgtatgtgctagg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39366239 |
cttatcagttggtctattcacactatgattgtatgtgctagg |
39366198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University