View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5953_low_26 (Length: 247)
Name: NF5953_low_26
Description: NF5953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5953_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 15 - 239
Target Start/End: Complemental strand, 32740150 - 32739926
Alignment:
| Q |
15 |
attattttccctatatcaaatgcacgatttaacgaactatatgataatacagccgtgaaaaagttagttaattacttggacaaattttttaaggaatgtc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32740150 |
attattttccctatatcaaatgcacgatttaacgaactatatgataatacagccgtggaaaagttagttaattacttggacaaattttttaaggaatgtg |
32740051 |
T |
|
| Q |
115 |
gtttaatttaatattaggtaattctatataatatttgtttatgataaactcgtgcaatataaacgaatgtgcttgcgtgtgagctttagtttgcgtgaca |
214 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32740050 |
gtttattttaatattagttaattctatataatattagtttatgataaactcgtgcaatataaacgaatgtgcttgcgtgtgagctttagtttgcgcgaca |
32739951 |
T |
|
| Q |
215 |
aagggcatgcgcatgtagaataatc |
239 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32739950 |
aagggcatgcgcatgtagaataatc |
32739926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University