View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5953_low_29 (Length: 235)
Name: NF5953_low_29
Description: NF5953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5953_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 41836087 - 41836320
Alignment:
| Q |
1 |
taatttttcatgccacatcatcccatttagatatgcagttctgcatcgatttttctttgttgagtcaaatatatgggcttatttcacttgtacaatatgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41836087 |
taatttttcatgccacatcatcccatttagatatgcagttctgcatcgattttcctttgttgagtcaaatatatgggcttatttcacttgtacaatatgg |
41836186 |
T |
 |
| Q |
101 |
atccatgtggctattaactcaatcattgtttgggttaaaccgtttgtcattataattaccgacaaagtatatcgt--------------cacatgcaaca |
186 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||| ||| |||||| |||||||||||||| |||||||||||| || |||||||| |
|
|
| T |
41836187 |
atccatgtgactattaactcaatcattatttgggttgaactgtttgtgattataattaccgataaagtatatcgtctacaatcatgacacatatgcaaca |
41836286 |
T |
 |
| Q |
187 |
tgtagcacaacaaacattttagaagtaacttcct |
220 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
41836287 |
tgtagcacaacaaatattttagaagtaacttcct |
41836320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University