View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5953_low_30 (Length: 231)
Name: NF5953_low_30
Description: NF5953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5953_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 16 - 213
Target Start/End: Original strand, 8246210 - 8246408
Alignment:
| Q |
16 |
atgaaagaattagaagctacactaaaactatttattttctttatatttaggtgtataagattaagcagttgctcaatttttaaaatgctactttcaattt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8246210 |
atgaaagaattagaagctacactaaaactatttattttctttatatttaggtgtataagattaagcagttgctcaatttttaaaatgctactttcaattt |
8246309 |
T |
 |
| Q |
116 |
agaattttttaaagggattgtagttttatacccaatca-nnnnnnnngaataatttttatatatatgccccaccaggtattgtaatttttatacccaat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8246310 |
agaattttttaaagggattgtagttttatacccaatcatttttttttaaataatttttatatatatgccccaccagggattgtaatttttatacccaat |
8246408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University