View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5953_low_32 (Length: 229)
Name: NF5953_low_32
Description: NF5953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5953_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 13 - 115
Target Start/End: Original strand, 34589788 - 34589890
Alignment:
| Q |
13 |
aatatcaatgttctaataaggtgaagagagatcaacttcgagctctatgcgaagaatttgagaatcttagcatgaagattgatgaatctctaaaggaata |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34589788 |
aatatcaatgttctaataaggtgaagagagatcaacttcgagctctatgcgaagaatttgagaatcttagcatgaagattgatgaatctctaaaggaata |
34589887 |
T |
 |
| Q |
113 |
ctt |
115 |
Q |
| |
|
||| |
|
|
| T |
34589888 |
ctt |
34589890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 114 - 209
Target Start/End: Original strand, 34589936 - 34590031
Alignment:
| Q |
114 |
ttgacccatgtaaccattgttgaaaagattctaagatctttaacataaagatttaattatgttgttttctcaatagaagaattgaatgatgcaact |
209 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34589936 |
ttgacccatataaccattgttgaaaagattctaagatctttaacataaagatttaattatgttgttttctcaatagaagaattgaatgatgcaact |
34590031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University