View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5954_high_33 (Length: 245)
Name: NF5954_high_33
Description: NF5954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5954_high_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 313826 - 313598
Alignment:
| Q |
1 |
gtttcttttctctatatattataagcttgaatcgatttggttaatgattgagtaattaatctgctccaactctgttgtagcatggaatttgacaatttac |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
313826 |
gtttcttttctccatatattataagcttgaatcgatttgattaatgattgagtaattaatctgctccaactctgttgtagcattgaatttgacaatttac |
313727 |
T |
 |
| Q |
101 |
gatcctccttttgtcgttatacaggccaggaaatttggagttcgttctgccatgcctggctttattgcacggaagctatgtccagagttaatctttgttc |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
313726 |
gatcctccttttgtctttatacaggccaggaaatttggagttcgttctgccatgcctggctttattgcacggaagctatgtccagagttaatctttgttc |
313627 |
T |
 |
| Q |
201 |
cagttgacttcaagaagtatactcattac |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
313626 |
cagttgacttcaagaagtatactcattac |
313598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University