View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5954_low_21 (Length: 335)
Name: NF5954_low_21
Description: NF5954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5954_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 136 - 316
Target Start/End: Complemental strand, 54703571 - 54703394
Alignment:
| Q |
136 |
catgacattagctttctttcaatcaactgctttataatgtattacattgtgacaatatcgttagatcattgtgacattagctttagaatttcttatgaag |
235 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54703571 |
catgacattagctttctttcaatcaactactttataatgtattacattgtgacaatat----agatcattgtgacattagctttagaatttcttatgaag |
54703476 |
T |
|
| Q |
236 |
ctcgctgtcgtccatgttgtcgcatcagaacatcttctgaatctggt-aatataacatggtcgatgaactaacagtgaagtt |
316 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
54703475 |
cccgctgtcgtccatgttgtcgcatcagaacatcttatgaatctggtaaatataacatggtcgatgaactaacagtgaagtt |
54703394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 16 - 78
Target Start/End: Complemental strand, 54703691 - 54703629
Alignment:
| Q |
16 |
atgctggaataattttcggattagaagttaaagcttgataaagagatcttgggtttgagtttg |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
54703691 |
atgctggaataattttcggattagaagttaaagcttgttaaagagatcttgggtttgagtttg |
54703629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University