View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5954_low_23 (Length: 332)
Name: NF5954_low_23
Description: NF5954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5954_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 2 - 314
Target Start/End: Original strand, 1578382 - 1578700
Alignment:
| Q |
2 |
ggccacaattgcggtcgcggtgctttcacatatgcctcgtaaaccttgaggttaccgccgcaattgtggttgaaccagcgcaatttaaaaccttgcatgc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1578382 |
ggccacaattgcggtcgcggtgctttcacatatgcctcgtaaaccttgaggttaccgccgcaattgtggttgaaccagcgcaatttaaaaccttgcatgc |
1578481 |
T |
 |
| Q |
102 |
aagttaattgatagacaagcaatctccatcttcaata--aattg--ta-----ttttttcccggtaaaatctaactcttgatcatcaatcaatgagcctc |
192 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| || | || |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1578482 |
aagttaattaatagacaagcaatctccatcttcaatattgataggttaacaattttttttccggtaaaatctaactcttgatcatcaatcaatgagcctc |
1578581 |
T |
 |
| Q |
193 |
nnnnnnnnnnncttcattaaattgtannnnnnnnaactccgtatcggactcgaaaaccaactaatcatatgaaccaatccaccatccatagtctggtttc |
292 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1578582 |
---ttttttttcttcattaaattgtattttgtttaactccgtatcgcactcgaaaaccaactaatcatatgaaccaatccaccatccatagtctggtttc |
1578678 |
T |
 |
| Q |
293 |
cttcattaaattgtgttaatta |
314 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1578679 |
cttcattaaattgtgttaatta |
1578700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University