View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5955_high_5 (Length: 282)
Name: NF5955_high_5
Description: NF5955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5955_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 30217323 - 30217472
Alignment:
| Q |
1 |
ctttggtcattcattcattccttgcccctcccatattgtttgtgttcttttctttcactgcttttaattaagtatataggcccattgtttccttcttttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30217323 |
ctttggtcattcattcattccttgcccctcccatattgtttgtgttcttttctttcactgcttttaattaagtatataggcccattgtttccttcttttg |
30217422 |
T |
 |
| Q |
101 |
agatttttgagatcacttttgatcttgctctaatcccgagctagcttccc |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30217423 |
agatttttgagatcacttttgatcttgctctaatcccgagctagcttccc |
30217472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 220 - 267
Target Start/End: Original strand, 30217543 - 30217590
Alignment:
| Q |
220 |
ctctttttgtattatgcttattttgcattttaactcttgttagtacat |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30217543 |
ctctttttgtattatgcttattttgcattttaactcttgttagtacat |
30217590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University