View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5958_high_23 (Length: 233)
Name: NF5958_high_23
Description: NF5958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5958_high_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 48 - 211
Target Start/End: Original strand, 10818001 - 10818164
Alignment:
| Q |
48 |
gtattatatactcccttggtccctatatatatggtatgtgtcttaattttcccacaatgtgatatcgtaaaatgtgttattaatgtctcttgtgatgcag |
147 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10818001 |
gtattatatactccctcagtccctgtatatatggtatgtgtcttaattttcccacaatgtgatatcgtaaaatgtgttattaatgtctcttgtgatgcag |
10818100 |
T |
 |
| Q |
148 |
attgaatgcctagtagatcagatatgcaacatgacaataatgtcactagacacatggtatgttt |
211 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10818101 |
attgaatgcctagtagatcacatatgcaacgtgacaataatgtcactagacacatggtatgttt |
10818164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University