View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5958_high_25 (Length: 218)
Name: NF5958_high_25
Description: NF5958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5958_high_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 29 - 205
Target Start/End: Complemental strand, 10922040 - 10921867
Alignment:
| Q |
29 |
gggatacatggctatgctaatcacatgccgactcacattaaataattattttaacagtaataaaattttggattttgctaactggttcccaaaacattga |
128 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| | |||||||| |||| || ||||||||| |
|
|
| T |
10922040 |
gggatacatggctatgctaatcatatgccgactcacattaaataattattttaatagtaataaaattttgggtcttgctaaccggtt-ccgaaacattga |
10921942 |
T |
|
| Q |
129 |
ttaaggaatccatcaattaatgtcacaccannnnnnnatgaaaacttacttgttttgtatgtttaattaatacccct |
205 |
Q |
| |
|
|||| |||||||||||||||||| ||||| ||||||| |||||| |||||||||||||| |||||||||| |
|
|
| T |
10921941 |
ttaatgaatccatcaattaatgt--caccatttttttatgaaaatttacttattttgtatgtttaactaatacccct |
10921867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University