View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5958_low_17 (Length: 260)
Name: NF5958_low_17
Description: NF5958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5958_low_17 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 12 - 166
Target Start/End: Complemental strand, 44949234 - 44949080
Alignment:
| Q |
12 |
ataggggaaaagaaatctggctactttacttcctttccatgtttttcttgtgagcgaatgagcttttgttcacccgatggcgttgtctctacaggagcat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44949234 |
ataggggaaaagaaatctggctactttacttcctttccatgtttttcttgtgagcgaatgagcttttgttcacccgatggcgttgtctctccaggagcat |
44949135 |
T |
|
| Q |
112 |
gtgtctattatcagaaatggttggatttctgagtgagttgattactactgaatga |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44949134 |
gtgtctattatcagaaatggttggatttctgaatgagttgattactactgaatga |
44949080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 18 - 139
Target Start/End: Complemental strand, 6470089 - 6469968
Alignment:
| Q |
18 |
gaaaagaaatctggctactttacttcctttccatgtttttcttgtgagcgaatgagcttttgttcacccgatggcgttgtctctacaggagcatgtgtct |
117 |
Q |
| |
|
||||||||||||| ||| ||| |||||||||||||||||||| | || ||||||||||||||| | ||||| ||||||||| || | ||||||| | |
|
|
| T |
6470089 |
gaaaagaaatctgctgactcgactccctttccatgtttttcttgtcaacggatgagcttttgttcatcggatggtgttgtctctccaacaacatgtgtgt |
6469990 |
T |
|
| Q |
118 |
attatcagaaatggttggattt |
139 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
6469989 |
attttcagaaatggttggattt |
6469968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 181 - 224
Target Start/End: Complemental strand, 44949063 - 44949019
Alignment:
| Q |
181 |
ataaacgactctcc-aagttttgactcacataacagctattgtgg |
224 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44949063 |
ataaacgactctcccaagttttgactcacataacagctattgtgg |
44949019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 18 - 150
Target Start/End: Original strand, 419595 - 419727
Alignment:
| Q |
18 |
gaaaagaaatctggctactttacttcctttccatgtttttcttgtgagcgaatgagcttttgttcacccgatggcgttgtctctacaggagcatgtgtct |
117 |
Q |
| |
|
||||||||||||| ||| ||| |||||||||||||||||||| | || ||||||||||||||| | || || ||||||||| || | ||||||||| |
|
|
| T |
419595 |
gaaaagaaatctgttgactcgactccctttccatgtttttcttgtcaacggatgagcttttgttcaacagacggtgttgtctctccaacaacatgtgtct |
419694 |
T |
|
| Q |
118 |
attatcagaaatggttggatttctgagtgagtt |
150 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||| |
|
|
| T |
419695 |
attatcagaaatggttggatttttgaatgagtt |
419727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University