View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5958_low_26 (Length: 215)
Name: NF5958_low_26
Description: NF5958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5958_low_26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 26320076 - 26319877
Alignment:
| Q |
1 |
tgaagatgtagtagcatctggttcactagaagatgaagttgcttgagttagttccctaagttgtgaatgcatgttgtttatgaaagccattgaattctgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26320076 |
tgaagatgtagtagcatctggttcactagaagatgaagttgcctgagttagttccctaagttgtgaatgcatgttgtttatgaaagccattgaattctgt |
26319977 |
T |
|
| Q |
101 |
tgtggttccttcattgcttcttttagcttactaagtgccaaacaatatgcttcctgcatgtattggtttaataatattcatgagattaattttgattcat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26319976 |
tgtggttccttcattgcttcttttagcttactaagtgccaaacaatatgcttcctgcatatattggtttaataatattcatgagattaattttgattcat |
26319877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University