View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5958_low_28 (Length: 208)
Name: NF5958_low_28
Description: NF5958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5958_low_28 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 26 - 208
Target Start/End: Original strand, 10922086 - 10922268
Alignment:
| Q |
26 |
tagcatgtctctttcaaagtaaaactttttagagattaaaatcaaagtgacccctatatttataaagatttttacataaaacatgtaccttaaccccgca |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10922086 |
tagcatgtctctttcaaagtaaaactttttagagattaaaatcaaagtgacccctatatttataaggatttttacataaaacatgtaccttaaccccgca |
10922185 |
T |
 |
| Q |
126 |
tcctatcctataatctttaatcctagcctcagtattaaaatggaatcaaaattgttagtgctgagcataacactattggaaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10922186 |
tcctatcctataatctttaatcctagcctcagtattaaaatggaatcaaaattgttagtgcttagcataacactattggaaat |
10922268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University