View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5958_low_28 (Length: 208)

Name: NF5958_low_28
Description: NF5958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5958_low_28
NF5958_low_28
[»] chr8 (1 HSPs)
chr8 (26-208)||(10922086-10922268)


Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 26 - 208
Target Start/End: Original strand, 10922086 - 10922268
Alignment:
26 tagcatgtctctttcaaagtaaaactttttagagattaaaatcaaagtgacccctatatttataaagatttttacataaaacatgtaccttaaccccgca 125  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
10922086 tagcatgtctctttcaaagtaaaactttttagagattaaaatcaaagtgacccctatatttataaggatttttacataaaacatgtaccttaaccccgca 10922185  T
126 tcctatcctataatctttaatcctagcctcagtattaaaatggaatcaaaattgttagtgctgagcataacactattggaaat 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
10922186 tcctatcctataatctttaatcctagcctcagtattaaaatggaatcaaaattgttagtgcttagcataacactattggaaat 10922268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University