View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5960_high_2 (Length: 221)
Name: NF5960_high_2
Description: NF5960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5960_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 7 - 202
Target Start/End: Complemental strand, 29452119 - 29451927
Alignment:
| Q |
7 |
tggagtagcataggacagaaacgacactgtcaaataggcttacaggctatgcaagaaaacctggtggccaggatatgctttggagcattcacatcccatc |
106 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29452119 |
tggagttgcacaggacagaaacgacactgtcaaataggcttacaggctatgcaagaaaacctggtggccaggatatgctttggagcattcacatcccatc |
29452020 |
T |
 |
| Q |
107 |
caaaatcaaaactctcctctggtggttatgtcacaatgttcaatgccattgcagagtgcagacagaggagagtacagagcatatgatggtgcactg |
202 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29452019 |
caaaatcaaaact---ctctggtggttatgtcacaatgttcaatgccattgcagagtgcagacagaggagagtacagagcatatgatggtgcactg |
29451927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University