View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5961_high_13 (Length: 375)
Name: NF5961_high_13
Description: NF5961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5961_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 5e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 8 - 211
Target Start/End: Original strand, 8057029 - 8057229
Alignment:
| Q |
8 |
tgaaatgaattagaaaaacagtatgggaattaagatgcttgtttaatactaataggtcggtcccatactgccaaatgcaaccactttcgacggggcctcc |
107 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8057029 |
tgaaatgaattagagaaacagtatgggaattaagatgcttgtttaatac-aataggtcggtcccatactgccaaatgcaaccactttcgacggggcctcc |
8057127 |
T |
 |
| Q |
108 |
tgtcacggttagagttgannnnnnnnnnnnnacccactttactgcctactccacaatctaaggtccatacaaatttgtcagaactcataactcagtaatc |
207 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8057128 |
tgtcacggttagagttga--gggtgtgtgtgacccactttactgcctactccacaatctaaggtccatacaaatttgtcagaactcataactcagtaatc |
8057225 |
T |
 |
| Q |
208 |
aaat |
211 |
Q |
| |
|
|||| |
|
|
| T |
8057226 |
aaat |
8057229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University