View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5961_high_51 (Length: 244)
Name: NF5961_high_51
Description: NF5961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5961_high_51 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 78 - 244
Target Start/End: Complemental strand, 15250598 - 15250432
Alignment:
| Q |
78 |
ttgacggatgccacttgtattgtattttctagaggtttttagtttcttgtttggggcctagaatgtcattttgatgttagtccaatgtcttttggtgttc |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15250598 |
ttgacggatgccacttgtattgtattttctagaggtttttagtttcttgtttggtgcctagaatgtcattttgatgttagtccaatgtcttttggtgttc |
15250499 |
T |
 |
| Q |
178 |
gagacaccccagccattcttcaacaagctgctctcccaaatcttctctcttttcgtgttttgagttt |
244 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15250498 |
gaggcaccccagccattcttcaacaagctgctctcccaaatcttctctcttttcgtgctttgagttt |
15250432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 136 - 176
Target Start/End: Complemental strand, 15231677 - 15231637
Alignment:
| Q |
136 |
tagaatgtcattttgatgttagtccaatgtcttttggtgtt |
176 |
Q |
| |
|
|||||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
15231677 |
tagaatgtgattttgatattaatccaatgtcttttggtgtt |
15231637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University