View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5961_high_52 (Length: 239)
Name: NF5961_high_52
Description: NF5961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5961_high_52 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 229
Target Start/End: Original strand, 15250074 - 15250285
Alignment:
| Q |
18 |
ttctggacagtttgctggtgcaaatattctaacttcatgttatatttcaaatctttatattaaggatagtcaaagaaatgatcgtgccccacatgccgat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15250074 |
ttctggacagtttgctggtgcaaatattctaacttcatgttatatttcaaatctttatattaaggatagtcaaagaaatgatcgtgccccacatgccgat |
15250173 |
T |
 |
| Q |
118 |
gaagttcatgtgtattttgataaacctctttgttatgatgcaaattacgttgataatttacgtgatgatttgcaacgtgttgtgttgtttgggggacctg |
217 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15250174 |
gaagttcacgtgtattttgataaacctctttgttatgatgcaaattacgttgataatttacgtgatgatttgcaacgtgttgtgttgtttggtggacctg |
15250273 |
T |
 |
| Q |
218 |
gtggattctgtg |
229 |
Q |
| |
|
|||||||||||| |
|
|
| T |
15250274 |
gtggattctgtg |
15250285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University