View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5961_high_57 (Length: 227)
Name: NF5961_high_57
Description: NF5961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5961_high_57 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 40331170 - 40330950
Alignment:
| Q |
7 |
gaatgtttacccatttggggatggtgtcactgggaaagcttattgtggtttgacagtaatcactgctactagctgctttcagaccaagtccatttgcact |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40331170 |
gaatgtttacccatttggggatggtgtcactgggaaaacttattgtggtttgacagtaatcactgctactagctgctttcagaccaagtccatttgcact |
40331071 |
T |
|
| Q |
107 |
ctgcagaaaacaccaaatcagctactcggtcaaatcgttcaaataattcatactcagtacaagattggaaaattgggagtataaataagaaaacaaatca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40331070 |
ctgcagaaaacaccaaatcagctactcggtcaaatcgttcaaataattcatactcagtacaagattggaaaattgggagtataaataagaaaacaaatca |
40330971 |
T |
|
| Q |
207 |
gaaccaaaatactactacaat |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40330970 |
gaaccaaaatactactacaat |
40330950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University