View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5961_low_15 (Length: 336)
Name: NF5961_low_15
Description: NF5961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5961_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 101 - 321
Target Start/End: Original strand, 45760626 - 45760846
Alignment:
| Q |
101 |
gctatatcaaacacaaactaaaatgaacttacaaataaaactaaaatgaacaacaagttgcgcttatattttattaagtggggtgtctcacctacttaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45760626 |
gctatatcaaacacaaactaaaatgaacttacaaataaaactaaaatgaacaacaagttgcgcttatattttattaagtggggtatctcacctacttaca |
45760725 |
T |
 |
| Q |
201 |
ttagtaatatgctagatagtgcccaaaataattgtatttgcttattatgttgtaaagaatgaagaaaaaggtagtcaaaaatagctttattggtttggtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45760726 |
ttagtaatatgctagatagtgcccaaaataattgtaattgcatattatgtagtaaagaatgaagaaaaaggtagtcaaaaatagctttattgatttggtt |
45760825 |
T |
 |
| Q |
301 |
caaccatgctcaacatatagg |
321 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45760826 |
caaccatgctcaacatatagg |
45760846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University