View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5961_low_34 (Length: 270)
Name: NF5961_low_34
Description: NF5961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5961_low_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 83 - 213
Target Start/End: Complemental strand, 38690685 - 38690555
Alignment:
| Q |
83 |
attagacgggattggataagaagaaaataatggtggtgtttggggtattttctcttgttcctctcaagttttttcttatgattttttcgtgcaacttacc |
182 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38690685 |
attaaacgggattggataagaagaaaataatggtggtgtttggggtattttctcttgttcctctcaagttttttcttatgattttttcgtgtaacttacc |
38690586 |
T |
|
| Q |
183 |
tgacctggtcttcgattttatagtcccaatc |
213 |
Q |
| |
|
|||| | |||||||||||||||||||||||| |
|
|
| T |
38690585 |
tgacatcgtcttcgattttatagtcccaatc |
38690555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 100 - 180
Target Start/End: Complemental strand, 38703507 - 38703425
Alignment:
| Q |
100 |
aagaagaaaataatggtggtgttt-ggggtattt-tctcttgttcctctcaagttttttcttatgattttttcgtgcaactta |
180 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||| ||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
38703507 |
aagaagaaaataatggtggtgttttggggtgtttctctcttgttcctctcaagttttttcctatgattttttcgtgtaactta |
38703425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 217 - 248
Target Start/End: Original strand, 37562340 - 37562371
Alignment:
| Q |
217 |
aagtcaattttaaccattagatctacaatctt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37562340 |
aagtcaattttaaccattagatctacaatctt |
37562371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University