View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5961_low_37 (Length: 264)
Name: NF5961_low_37
Description: NF5961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5961_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 8 - 248
Target Start/End: Original strand, 52180960 - 52181203
Alignment:
| Q |
8 |
tgaatgcaatgcagatgtaatcaagcaagcagtatctttagcaccatcattatacaaatggtagttcattttaaagatatcatatggcac-----tcatg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52180960 |
tgaatgcaatgcagatgtaatcaagcaagcagtatctttagcaccatcattatacaaatggtagttcattttaaagatatcatatggcactcatgtcatg |
52181059 |
T |
 |
| Q |
103 |
ttcacttgcattggaatttgtttttgcaaaaacacactcataacataatgataaatacaacaactaatnnnnnnnncaaataaagacaattcccacatga |
202 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
52181060 |
ttcacttgcattggaatttg-ttttgcaaaaacacactcataacataatgataaatacaacaactaat-aaaaaaacaaataaagacaattcctacatga |
52181157 |
T |
 |
| Q |
203 |
gttttcaaatacattcaaagcactaaagattttgaatccttctaag |
248 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52181158 |
gttttcaaacacattcaaagcactaaagattttgaatccttctaag |
52181203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University