View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5961_low_48 (Length: 249)
Name: NF5961_low_48
Description: NF5961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5961_low_48 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 26499598 - 26499373
Alignment:
| Q |
1 |
gattagaagccactggggaaactgcatggtgaggggtaaagagcttaactgtttctgcatgcacatatatagagaaggtaatta-----atggtcacaac |
95 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
26499598 |
gattagaagccactagggaaactgcatggtgagggctaaagagcttaac---------------atatatagagaaggtaattatattaatggtcacaac |
26499514 |
T |
|
| Q |
96 |
ttatctatgactttgacacaaggctagttggaatcttc---ctcctttattcattagtccctttttgtacatagaatgcatgggtttgccttgttttaga |
192 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| || |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26499513 |
ttatctatgactttgacacaagactagttggaatgttattactcctttattcattaggccctttttgtacatagaatgcatgggtttgccttgttttaga |
26499414 |
T |
|
| Q |
193 |
gttgtttctgtctaacttttcctttggtttggtctttctgt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26499413 |
gttgtttctgtctaacttttcctttggtttggtctttctgt |
26499373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 187 - 235
Target Start/End: Complemental strand, 26499358 - 26499310
Alignment:
| Q |
187 |
tttagagttgtttctgtctaacttttcctttggtttggtctttctgtat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26499358 |
tttagagttgtttctgtctaacttttcctttggtttggtctttctgtat |
26499310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University