View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5961_low_50 (Length: 246)
Name: NF5961_low_50
Description: NF5961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5961_low_50 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 101 - 211
Target Start/End: Original strand, 37731755 - 37731856
Alignment:
| Q |
101 |
aaaggattgtaccattgtcactctgcattttatgttaggaagtatttattttgatattaatattagtattgttgttattgttactccaattatttttgag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
37731755 |
aaaggattgtaccattgtcactctgcattttatgttaggaagtatttattttgatattaatattagtattgttg---------ctccaatgatttttgag |
37731845 |
T |
 |
| Q |
201 |
ctgaatttttg |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
37731846 |
ctgaatttttg |
37731856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 13 - 69
Target Start/End: Original strand, 37731667 - 37731723
Alignment:
| Q |
13 |
atattttcaaaatggtagttgttcattggagtggtaatttatgaattaaattaattg |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37731667 |
atattttcaaaatggtagttgttcattggagtggtaatttaggaattaaattaattg |
37731723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University