View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5961_low_52 (Length: 244)

Name: NF5961_low_52
Description: NF5961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5961_low_52
NF5961_low_52
[»] chr8 (2 HSPs)
chr8 (78-244)||(15250432-15250598)
chr8 (136-176)||(15231637-15231677)


Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 78 - 244
Target Start/End: Complemental strand, 15250598 - 15250432
Alignment:
78 ttgacggatgccacttgtattgtattttctagaggtttttagtttcttgtttggggcctagaatgtcattttgatgttagtccaatgtcttttggtgttc 177  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
15250598 ttgacggatgccacttgtattgtattttctagaggtttttagtttcttgtttggtgcctagaatgtcattttgatgttagtccaatgtcttttggtgttc 15250499  T
178 gagacaccccagccattcttcaacaagctgctctcccaaatcttctctcttttcgtgttttgagttt 244  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
15250498 gaggcaccccagccattcttcaacaagctgctctcccaaatcttctctcttttcgtgctttgagttt 15250432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 136 - 176
Target Start/End: Complemental strand, 15231677 - 15231637
Alignment:
136 tagaatgtcattttgatgttagtccaatgtcttttggtgtt 176  Q
    |||||||| |||||||| ||| |||||||||||||||||||    
15231677 tagaatgtgattttgatattaatccaatgtcttttggtgtt 15231637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University