View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5961_low_58 (Length: 227)

Name: NF5961_low_58
Description: NF5961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5961_low_58
NF5961_low_58
[»] chr8 (1 HSPs)
chr8 (7-227)||(40330950-40331170)


Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 40331170 - 40330950
Alignment:
7 gaatgtttacccatttggggatggtgtcactgggaaagcttattgtggtttgacagtaatcactgctactagctgctttcagaccaagtccatttgcact 106  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40331170 gaatgtttacccatttggggatggtgtcactgggaaaacttattgtggtttgacagtaatcactgctactagctgctttcagaccaagtccatttgcact 40331071  T
107 ctgcagaaaacaccaaatcagctactcggtcaaatcgttcaaataattcatactcagtacaagattggaaaattgggagtataaataagaaaacaaatca 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40331070 ctgcagaaaacaccaaatcagctactcggtcaaatcgttcaaataattcatactcagtacaagattggaaaattgggagtataaataagaaaacaaatca 40330971  T
207 gaaccaaaatactactacaat 227  Q
    |||||||||||||||||||||    
40330970 gaaccaaaatactactacaat 40330950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University