View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5961_low_62 (Length: 219)
Name: NF5961_low_62
Description: NF5961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5961_low_62 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 55060883 - 55060741
Alignment:
| Q |
1 |
gttctgttgtttttgcttcggaaacatgtgcacttgatttgattgaagctacttatgaaagagaggtttgtcctggtgagattgtggttgtggataaaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
55060883 |
gttctgttgtttttgcttcggaaacatgtgcacttgatttgattgaagctacttatgaaagagaggtttatcctggtgagattgtggttgtggataaaag |
55060784 |
T |
|
| Q |
101 |
tggtgttcaatctcattgtcttgtttctcgtccagaaccaaaa |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55060783 |
tggtgttcaatctcattgtcttgtttctcgtccagaaccaaaa |
55060741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 80
Target Start/End: Complemental strand, 27357064 - 27356988
Alignment:
| Q |
4 |
ctgttgtttttgcttcggaaacatgtgcacttgatttgattgaagctacttatgaaagagaggtttgtcctggtgag |
80 |
Q |
| |
|
|||||||||||||||| || || ||||| |||||||||||||||||||||||||| || || |||| ||||||||| |
|
|
| T |
27357064 |
ctgttgtttttgcttctgagacttgtgctcttgatttgattgaagctacttatgagagggaagttttccctggtgag |
27356988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University