View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5961_low_63 (Length: 218)
Name: NF5961_low_63
Description: NF5961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5961_low_63 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 35394164 - 35393984
Alignment:
| Q |
18 |
tactatagccttcataattttcatcacatgcccatgttttgcggagagnnnnnnngtgttaaactttgcaaagcattttggctactagttgatttggcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35394164 |
tactatagccttcataattttcatcacatgcccatgttttgcggagagttttttt-tgttaaactttgcaaagcattttggctactagttgatttggcaa |
35394066 |
T |
 |
| Q |
118 |
gggaaacaaactcgtggtagattgtgnnnnnnnnaatcgggtatctccgtgtgtatcggtagagattaatctctcgagtcag |
199 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
35394065 |
gggaaacaaactcgtggtagattgtgttttttttaatcgggtatttctgtgtgtatcggtagagattaatctctcgagtcag |
35393984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University