View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5962_high_18 (Length: 317)
Name: NF5962_high_18
Description: NF5962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5962_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 52; Significance: 8e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 31 - 98
Target Start/End: Complemental strand, 2008681 - 2008614
Alignment:
| Q |
31 |
cgagtctactatatggttccatacttattaacataacaatagaaaatcatacttattttagtctaaac |
98 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| || |||||| ||||||||| |
|
|
| T |
2008681 |
cgagtctactatacggttccatacttattaacataacaatagaaaatcctatttatttcagtctaaac |
2008614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 170 - 304
Target Start/End: Complemental strand, 2008598 - 2008467
Alignment:
| Q |
170 |
atttggggtaaccatgacagacaaatgtatattctatataaagatctatctacctacaaaacatcannnnnnng-gtactattaacatgttttcccttgt |
268 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||| ||| ||| |||| |||||||| ||||| |||| |||||||||||| |||||||||| |
|
|
| T |
2008598 |
atttggggtaactatgacagacaaatttatatactagata--gatccatctacctgcaaaatatcaattttttttgtactattaacaa--tttcccttgt |
2008503 |
T |
 |
| Q |
269 |
ttacaatagctttctgattacttctaaaccatgatg |
304 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2008502 |
ttacaatagctttctgataacttctaaaccatgatg |
2008467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University