View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5962_low_27 (Length: 224)

Name: NF5962_low_27
Description: NF5962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5962_low_27
NF5962_low_27
[»] chr4 (1 HSPs)
chr4 (58-208)||(26787502-26787652)


Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 58 - 208
Target Start/End: Complemental strand, 26787652 - 26787502
Alignment:
58 acaccaacttccacctccgaagactttcctatgtcttctgaaggcggtgacggttatgacatggatgatgctggtcctacttacgtttgggggactaaca 157  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
26787652 acaccaacttccacctccgaagactttcctatgtcttctgaaggcggtgacggttatgacatggatgatgctggtcctacttacgtttggggtactaaca 26787553  T
158 ttagcgtggaggatgttaacgatgcgattcagaggtttttgaagcatttta 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
26787552 ttagcgtggaggatgttaacgatgcgattcagaggtttttgaagcatttta 26787502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University