View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5962_low_27 (Length: 224)
Name: NF5962_low_27
Description: NF5962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5962_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 58 - 208
Target Start/End: Complemental strand, 26787652 - 26787502
Alignment:
| Q |
58 |
acaccaacttccacctccgaagactttcctatgtcttctgaaggcggtgacggttatgacatggatgatgctggtcctacttacgtttgggggactaaca |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26787652 |
acaccaacttccacctccgaagactttcctatgtcttctgaaggcggtgacggttatgacatggatgatgctggtcctacttacgtttggggtactaaca |
26787553 |
T |
|
| Q |
158 |
ttagcgtggaggatgttaacgatgcgattcagaggtttttgaagcatttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26787552 |
ttagcgtggaggatgttaacgatgcgattcagaggtttttgaagcatttta |
26787502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University