View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5963_high_10 (Length: 223)
Name: NF5963_high_10
Description: NF5963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5963_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 7108697 - 7108477
Alignment:
| Q |
1 |
gcagaagtatttctagattggtggatgaaggtaagctagaccttatcaaggggtccagaaaaccata----------------gtaatctcattgattca |
84 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7108697 |
gcagaggtatttctagattggtggatgaaggtaagctagaccttatcaaggggtccagaaaaccatatgtccagaaaaccatagtaatctcattgattca |
7108598 |
T |
 |
| Q |
85 |
aggaatactgatacacaatttgttcttatatggtttgccattttcattgttaaaagatttggagagaagcattaggaacttcatttggagtggggacatt |
184 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7108597 |
aggaatactgatacacaatttgtccttatatgctttgctattttcattgttaaaagatttggagagaagcattaggaacttcatttggagtggggacatt |
7108498 |
T |
 |
| Q |
185 |
gagaagaggaaattagtcatt |
205 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7108497 |
gagaagaggaaattagtcatt |
7108477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University