View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5963_high_5 (Length: 305)
Name: NF5963_high_5
Description: NF5963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5963_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 19306501 - 19306630
Alignment:
| Q |
1 |
ttagttacatgaaaatgattaattaagctgagtagatgctcaattcagattgaaaattccgattaattcatgtagttgaaatttaccacttggccaagaa |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19306501 |
ttagttacatgtaaatgattaattaagctgagtagatgctcaattcagattgaaaattccgattaattcatgtagttg-aatttaccacttggccaagaa |
19306599 |
T |
 |
| Q |
101 |
ttgaatttttctttaactcaattgtattaac |
131 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |
|
|
| T |
19306600 |
ttgaatttttcattaactcaattgtattaac |
19306630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 240 - 289
Target Start/End: Original strand, 19306883 - 19306933
Alignment:
| Q |
240 |
atattgcgcgtaattgaacttggaatggccat-cccaacccctagggttta |
289 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
19306883 |
atattgcgcgtaattgaacttggaatggtcatccccaacccctagggttta |
19306933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 127 - 158
Target Start/End: Original strand, 19306639 - 19306670
Alignment:
| Q |
127 |
ttaacattcaaatttagtatgttaattttgct |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19306639 |
ttaacattcaaatttagtatgttaattttgct |
19306670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University