View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5963_low_4 (Length: 373)
Name: NF5963_low_4
Description: NF5963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5963_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 2e-99; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 18 - 213
Target Start/End: Original strand, 25966567 - 25966762
Alignment:
| Q |
18 |
gcttggtcttagaatctgtttcaaccttgaatatattgaaatcgagcacgtatctgctagacttataatggctttgtctcagaatctgtttgaaccttga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25966567 |
gcttggtcttagaatctgtttcaaccttgaatatattgaaatcgagcacgtatctgctagacttataatggctttgtctcagaatctgtttgaaccttga |
25966666 |
T |
|
| Q |
118 |
atatatctagcatatatgtgctagatttcaacatattaaaatactggtttgtgctcgatttcaaatgagtttcatttcaatttttcgcttccttag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25966667 |
atatatctagcatatatgtgctagatttcaacatattagaattctggtttgtgctcgatttcaaaggagtttcatttcaatttttcgcttccttag |
25966762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 220 - 307
Target Start/End: Original strand, 25966797 - 25966885
Alignment:
| Q |
220 |
tctaaattgttgctgt-tcagagctatatagttgaattcgatactcttgaccgtgccatttattgcaggaaaggcagtggtactcagaa |
307 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| | ||| ||| ||||| || |||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
25966797 |
tctaaattgttgctgtgtcagagctatatagtggcatttgatcctctttactgtgccatttattgcaggaaatgcagtggtacccagaa |
25966885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 79 - 123
Target Start/End: Original strand, 25966558 - 25966602
Alignment:
| Q |
79 |
cttataatggctttgtctcagaatctgtttgaaccttgaatatat |
123 |
Q |
| |
|
||||| ||||||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
25966558 |
cttattatggcttggtcttagaatctgtttcaaccttgaatatat |
25966602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University