View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5963_low_6 (Length: 252)
Name: NF5963_low_6
Description: NF5963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5963_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 7108895 - 7109135
Alignment:
| Q |
1 |
cattccacagtgtcaaaagctttataaatgtctattttaagggcaagattacctccaaaagatctattatggagaagatcggttgcctctcaagtgaggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
7108895 |
cattccacagtgtcaaaagctttataaatgtctattttaagggcaagattacctccaaaagatctattatggcgaagatcgggtgcctctcaagtgaggt |
7108994 |
T |
|
| Q |
101 |
tgatacactctttgatttgtctttgttgaataaatcctctttgatgattagaaatgaggttaggcatgattctagctaacctttcagcaatcactttggt |
200 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||| ||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7108995 |
tgatgcactctttgatttgtctgtgttgaataaattctctttgctgcttagaaatgaggttaggcatgattctagctaacctttcagcaatcactttggt |
7109094 |
T |
|
| Q |
201 |
tataattttaaacttgaagttatctaaagctataggcctat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7109095 |
tataattttaaacttgaagttatctaaagctataggtctat |
7109135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University