View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5963_low_8 (Length: 251)
Name: NF5963_low_8
Description: NF5963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5963_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 19306378 - 19306137
Alignment:
| Q |
1 |
tcactcaacaataacaattgaattatatgaaccgacaatataattattaatgcaatacatgagttcaagaaagatgatagaaataagaggtagaagaaa- |
99 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19306378 |
tcactcaacaataacaactgaattatatgaaccgacaatataattattaatgcaatacatgagttcaagaaagatgat-gaaataagaggtagaagaaat |
19306280 |
T |
 |
| Q |
100 |
nnnnnnngacaaaattacacttttgtcttttaagtacttaattttagataacggtttagttctttannnnnnnngttaa-tttttatccgtttgatctgt |
198 |
Q |
| |
|
||| |||||||||||||||| ||||||||||||||| | ||||||||||||||||||| ||||| ||||| || ||||| ||||| |
|
|
| T |
19306279 |
ttttcttgac--aattacacttttgtctcttaagtacttaatttcaaataacggtttagttctttattttttttgttaattttttttctgtttggtctgt |
19306182 |
T |
 |
| Q |
199 |
ttgcatatggatttcaagttctaaatctattgttttattttcttg |
243 |
Q |
| |
|
|||||||| ||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
19306181 |
ttgcatatagatttcaagctttaaatttattgttttattttcttg |
19306137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 198 - 243
Target Start/End: Original strand, 41316984 - 41317029
Alignment:
| Q |
198 |
tttgcatatggatttcaagttctaaatctattgttttattttcttg |
243 |
Q |
| |
|
||||||||||||||||||| | |||||||| |||||||||||||| |
|
|
| T |
41316984 |
tttgcatatggatttcaagcttcaaatctatggttttattttcttg |
41317029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 198 - 243
Target Start/End: Complemental strand, 1368385 - 1368340
Alignment:
| Q |
198 |
tttgcatatggatttcaagttctaaatctattgttttattttcttg |
243 |
Q |
| |
|
||||||||||||||||||| | ||||||||| ||||||||||||| |
|
|
| T |
1368385 |
tttgcatatggatttcaagctttaaatctatgattttattttcttg |
1368340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University