View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5963_low_9 (Length: 239)
Name: NF5963_low_9
Description: NF5963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5963_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 32929782 - 32929560
Alignment:
| Q |
1 |
cctcaatttattatagatacataatatttatagtcttaagtcagttaagtttattttacttatttctcttctattatgtagggtttttagctcaattgtc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32929782 |
cctcaatttattatagatacataatatttatagtcttaagtcagttaagtttattatacttatttctcttctattatgtagggtttttagctcaattgcc |
32929683 |
T |
 |
| Q |
101 |
aaaaatgatt---nnnnnnnntaagaattatgagacaaaacacattcgctagtcgagcaagagcaagctcaaagcgtggaattttataaagatcaaataa |
197 |
Q |
| |
|
|||||||||| |||||||||| || ||||||||||| |||||||||| ||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
32929682 |
aaaaatgattaaaaaaaaaaataagaattataaggcaaaacacatttgctagtcgagtaagagcaagctcaaagcgtgg-attttataaagatcaaagaa |
32929584 |
T |
 |
| Q |
198 |
aattgaaagggtaaatgcgctacg |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
32929583 |
aattgaaagggtaaatgcgctacg |
32929560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University