View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5964-Insertion-9 (Length: 225)
Name: NF5964-Insertion-9
Description: NF5964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5964-Insertion-9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 9 - 202
Target Start/End: Complemental strand, 41342163 - 41341970
Alignment:
| Q |
9 |
gatgttaattttcagggcaatgaagttccatttcaacccgccaagaagtttttacctgcaattcaagaggtcagcaagttacatgggaccatcttctggt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41342163 |
gatgttaattttcagggcaatgaagttccatttcaacctgccaagaagtttttacctgcaattcaagaggtcagcaagttacatgggaccatcttctggt |
41342064 |
T |
 |
| Q |
109 |
gctgtaatttaatatttttattttctctctttgaactaattggttggttcaatacagtaatgttgaaagatgtaataaattcacaggttctgct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
41342063 |
gctgtaatttaatatttttattttctctctttgaactaattgtttggttcaatacagtaatgttgaaagatgtaataaaatcacaggtgctgct |
41341970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University