View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5965-Insertion-12 (Length: 140)
Name: NF5965-Insertion-12
Description: NF5965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5965-Insertion-12 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 4e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 4e-64
Query Start/End: Original strand, 9 - 140
Target Start/End: Original strand, 44735128 - 44735259
Alignment:
| Q |
9 |
cattatgcaatcaagaggattcaaaaattggatccaaaactggattccatcgtctttgacgaacagagataacgcctccgttatcattttcagttaactt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44735128 |
cattatgcaatcaagaggattcaaaaattggatccaaaactggattccatcgtctttgacgaacagagataacgcctccgttatcattttccgttaactt |
44735227 |
T |
|
| Q |
109 |
atttactggtgaaacttttgcagtttcatttc |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44735228 |
ctttactggtgaaacttttgcagtttcatttc |
44735259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 4e-33
Query Start/End: Original strand, 10 - 134
Target Start/End: Original strand, 44745721 - 44745847
Alignment:
| Q |
10 |
attatgcaatcaagaggattcaaaaattggatccaaaactggattccatcgtctttgacgaacagaga--taacgcctccgttatcattttcagttaact |
107 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||| || ||||||||||| |||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
44745721 |
attatgtaatcaacaggattcaaaaattggatccaatacaggattccatcgcctttgacgaacagagagtaaacgcctccgttatcattttccgttaact |
44745820 |
T |
|
| Q |
108 |
tatttactggtgaaacttttgcagttt |
134 |
Q |
| |
|
| |||| |||||||||||||| |||| |
|
|
| T |
44745821 |
tcgttacgggtgaaacttttgccgttt |
44745847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University