View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5965_high_14 (Length: 330)
Name: NF5965_high_14
Description: NF5965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5965_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 20 - 205
Target Start/End: Complemental strand, 45153273 - 45153088
Alignment:
| Q |
20 |
aaatcttaagtgcatttactcctttttgtttgacaatataaagcacacaaagtagaacataccacatgagtgaaacgaagaaatggattcaaacaaagta |
119 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45153273 |
aaatcttaaatgcatttactcctttttgtttgacaatataaagcacacaaagtagaacataccacatgagtgaaacgaagaaatggattcaaacaaagta |
45153174 |
T |
 |
| Q |
120 |
ctaatagctctactaacccttgttttgctctttcattactctcttactgaaagtacaacactttctcataaccatcatagacacct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45153173 |
ctaatagctctactaacccttgttttgctctttcattactctcttactgaaagtacaacactttctcataaccatcatagacacct |
45153088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 278 - 318
Target Start/End: Complemental strand, 45153015 - 45152975
Alignment:
| Q |
278 |
cttaaggtgtgacccattttacctatatctatatggatatt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45153015 |
cttaaggtgtgacccattttacctatatctatatggatatt |
45152975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University