View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5965_high_17 (Length: 319)
Name: NF5965_high_17
Description: NF5965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5965_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 1 - 310
Target Start/End: Original strand, 41863160 - 41863469
Alignment:
| Q |
1 |
cacgggttgacttggtagcacgatagccattatgaagaaagaatttaaatacctccctgtatgtttctctaaacctctctttctttgttctttgtagatt |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41863160 |
cacgggttgccttggtagcacgatagccattatgaagaaagaatttaaatacctccctgtatgtttctctaaacctctctttctttgttctttgtagatt |
41863259 |
T |
 |
| Q |
101 |
tagaattacattaaggcttttaattaatttaaatgatttgttccagtaacaacattgcaatatctatgcaggttataggttggtcaatgtggtttgctga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41863260 |
tagaattacattaaggcttttaattaatttaaatgatttgttccagtaacaacattgcaatatctatgcaggttataggttggtcaatgtggtttgctga |
41863359 |
T |
 |
| Q |
201 |
atatttatttctagaaagaaactgggctaaagatgaatcatcattgaaggtaaataaatccaaaaatattattttattaatttagatatatatgtgatta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41863360 |
atatttatttctagaaagaaactgggctaaagatgaatcatcattgaaggtaaataaatcaaaaaatattattttattaatttagatatatatgtgatta |
41863459 |
T |
 |
| Q |
301 |
ttagtataat |
310 |
Q |
| |
|
|||||||||| |
|
|
| T |
41863460 |
ttagtataat |
41863469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 162 - 255
Target Start/End: Complemental strand, 42122079 - 42121986
Alignment:
| Q |
162 |
atctatgcaggttataggttggtcaatgtggtttgctgaatatttatttctagaaagaaactgggctaaagatgaatcatcattgaaggtaaat |
255 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||| | ||||||||| |||||||| |||||||| |||||| | || ||||||||||| |
|
|
| T |
42122079 |
atctgtgcaggttctaggttggtcaatgtggtttgctgattttttatttctggaaagaaattgggctaaggatgaactaacactgaaggtaaat |
42121986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University