View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5965_high_18 (Length: 303)
Name: NF5965_high_18
Description: NF5965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5965_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 251
Target Start/End: Complemental strand, 28672769 - 28672544
Alignment:
| Q |
19 |
tcttccataattgacaaccatggtctcggtctcatgggtgctggtcaattttccgtaaaggtttatgcattagacactatcatgggcgaggttggattac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28672769 |
tcttccataattgacaaccatggtctcggtctcatgggtgctggtcaattttccgtaaaggtttatgcattagacactatcatgggcgaggttggattac |
28672670 |
T |
 |
| Q |
119 |
aaggtcgaatctggtgggcatcctgggccgcacgggtgatgctcatttaccgttgctcgcagagccggccgagaaggattattggtatatggtggtaact |
218 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
28672669 |
agggtcgaatctggtgggcatcctgggccgcacgggtggtgctcatttaccattgctcgcagagccggctgagaaggattattggtatatggtagta--- |
28672573 |
T |
 |
| Q |
219 |
gtcctagtgtcttgatgacattttcttctctgc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28672572 |
----tagtgtcttgatgacattttcttctctgc |
28672544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 229 - 279
Target Start/End: Complemental strand, 28676185 - 28676135
Alignment:
| Q |
229 |
cttgatgacattttcttctctgctattgctcaaagttagttggtgaataat |
279 |
Q |
| |
|
|||||||| ||||||||| |||| ||||||||| |||||||||||||||| |
|
|
| T |
28676185 |
cttgatgatattttcttccttgctcttgctcaaaattagttggtgaataat |
28676135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University