View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5965_high_26 (Length: 251)
Name: NF5965_high_26
Description: NF5965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5965_high_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 13 - 228
Target Start/End: Complemental strand, 36544443 - 36544229
Alignment:
| Q |
13 |
aatatcattttgtttatcaaatagatgtaggattattaatttgtgtttcatgtgattgtatttgtgagtatagtttagagcaacataagcacttgtcatt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36544443 |
aatatcattttgtttatcaaatagatgtaggattattaatttgtgtttcctgtgattgtatttgtgagtatagtttagagcaacataagcacttgtcatt |
36544344 |
T |
|
| Q |
113 |
agattagagtgtcacacgtacaagaattttaataattatatgttttacatgatgtatttagataagggtagaaatagaagnnnnnnntattgtaactcat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
36544343 |
agattagagtgtcacacgtacaagaattttaataataatatgttttacatgatatatttagataagggtagaaatggaa-aaaaaaatattgtaactcat |
36544245 |
T |
|
| Q |
213 |
tttattccatttattt |
228 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
36544244 |
tttattccatttattt |
36544229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University