View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5965_high_3 (Length: 555)
Name: NF5965_high_3
Description: NF5965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5965_high_3 |
 |  |
|
| [»] scaffold0517 (2 HSPs) |
 |  |  |
|
| [»] scaffold0002 (5 HSPs) |
 |  |  |
|
| [»] scaffold0516 (2 HSPs) |
 |  |  |
|
| [»] scaffold0106 (2 HSPs) |
 |  |  |
|
| [»] scaffold0230 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |  |
|
| [»] scaffold0562 (1 HSPs) |
 |  |  |
|
| [»] scaffold0765 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold0684 (1 HSPs) |
 |  |  |
|
| [»] scaffold0160 (1 HSPs) |
 |  |  |
|
| [»] scaffold0095 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (2 HSPs) |
 |  |  |
|
| [»] scaffold0599 (1 HSPs) |
 |  |  |
|
| [»] scaffold0078 (1 HSPs) |
 |  |  |
|
| [»] scaffold0026 (2 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 9e-53; HSPs: 78)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 9e-53
Query Start/End: Original strand, 78 - 282
Target Start/End: Original strand, 24422515 - 24422720
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnna-gaaaatcgtccttgcaaaacattttgttt |
176 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||| ||| |||| ||||| ||||| |||| ||||| ||| ||||||||| |||||||| |
|
|
| T |
24422515 |
ggctaaaatatgcttttggtccctgtaaatatagtgaagttggattttgatccctggtaaaaaaaaaatttgaaaaacgtacttgcaaaaatttttgttt |
24422614 |
T |
 |
| Q |
177 |
ttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtggcatccaggtg |
276 |
Q |
| |
|
||||||||||||||| | |||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24422615 |
ttaaaaatagtccttagacccactttcttgctaatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtggcatccaggtg |
24422714 |
T |
 |
| Q |
277 |
gcaata |
282 |
Q |
| |
|
|||||| |
|
|
| T |
24422715 |
gcaata |
24422720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 78 - 281
Target Start/End: Complemental strand, 24427428 - 24427224
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnna-gaaaatcgtccttgcaaaacattttgttt |
176 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| || |||| ||||| |||||| |||| |||||| |||||||||||| |||||||| |
|
|
| T |
24427428 |
ggctaaaatatgtttttggtccctacaaatatagcgagtttgagttttagtccctggtaaaaattttatttgaaaattgtccttgcaaaattttttgttt |
24427329 |
T |
 |
| Q |
177 |
ttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtggcatccaggtg |
276 |
Q |
| |
|
|| |||||||||| || |||||||||||| ||||||||||||||| ||||||| || ||||||||||||||||||| |||||||||||||||||| || |
|
|
| T |
24427328 |
tttaaaatagtccctgaacccactttcttggtgatttgtctcatttttgcctatttgaaatatgctgactatgcaaacctgtacatgtggcatccagttg |
24427229 |
T |
 |
| Q |
277 |
gcaat |
281 |
Q |
| |
|
||||| |
|
|
| T |
24427228 |
gcaat |
24427224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 76 - 281
Target Start/End: Original strand, 35721099 - 35721302
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnnagaaaatcgtccttgcaaaacattttgtt |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| ||||| ||| | ||||||| |||||| |
|
|
| T |
35721099 |
taggctaaaatatgtttttggtccctgcaaatataacgaatttgggttttggtccctggtaaaaaaaatt--gaaaaacgttcctgcaaaattttttgta |
35721196 |
T |
 |
| Q |
176 |
tttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtggcatccaggt |
275 |
Q |
| |
|
||| |||||||||| ||| |||||||| | | ||||||||| ||||| ||| || ||||| |||||||| ||||||||| ||||||||||||| |||| |
|
|
| T |
35721197 |
ttttaaaatagtccctggtcccactttttcgatgatttgtcacatttatgcatacttggcagatgctgacggtgcaaacatttacatgtggcatctaggt |
35721296 |
T |
 |
| Q |
276 |
ggcaat |
281 |
Q |
| |
|
|||||| |
|
|
| T |
35721297 |
ggcaat |
35721302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 465 - 537
Target Start/End: Original strand, 24426291 - 24426363
Alignment:
| Q |
465 |
attcatcttaatcaaatcaaaattctggaaaactaaattcatcttcgtgcaagatcttcatcttcatcaattc |
537 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24426291 |
attcatcttaatcaaatcaaaattctggaaaactaaattcatcttcgtgcaacatcttcatcttcatcaattc |
24426363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 74 - 281
Target Start/End: Complemental strand, 34934810 - 34934602
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnna-gaaaatcgtccttgcaaaacatttt |
172 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||| |||||||||||||||||| | |||| ||||| ||||| ||||||| |||| |
|
|
| T |
34934810 |
tttaggctaaaatatgctttttgtccctgcaaatatagcgaatttgggttttggtccttggtaaaatttttttttgaaaaacgtccatgcaaaatttttt |
34934711 |
T |
 |
| Q |
173 |
gtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtggcatcca |
272 |
Q |
| |
|
|||||| |||||||||| ||| |||||||| | | ||||||||| ||||| ||| || | ||| |||||||| |||||| |||||||||||||||||| |
|
|
| T |
34934710 |
gttttttaaaatagtccctggtcccactttttcgatgatttgtcacatttatgcatactttgcagatgctgacggtgcaaatatgtacatgtggcatcca |
34934611 |
T |
 |
| Q |
273 |
ggtggcaat |
281 |
Q |
| |
|
||||||||| |
|
|
| T |
34934610 |
ggtggcaat |
34934602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 78 - 276
Target Start/End: Complemental strand, 37396899 - 37396700
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnna-gaaaatcgtccttgcaaaacattttgttt |
176 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||| |||||||||| | |||| ||||| ||||| ||||||| |||||||| |
|
|
| T |
37396899 |
ggctaaaatatgcttttggtccctgcaaatatagcgaatttgagttttggtccttggtaaaaaaattttttgaaaaacgtccctgcaaaattttttgttt |
37396800 |
T |
 |
| Q |
177 |
ttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtggcatccaggtg |
276 |
Q |
| |
|
|| |||||||||| ||| |||||||| | | ||||||||| ||||| ||| || ||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37396799 |
tttaaaatagtccctggtcccactttttcgatgatttgtcacatttatgcatacttggcagatgctgacggtgcaaacatgtacatgtggcatccaggtg |
37396700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 77 - 281
Target Start/End: Complemental strand, 35911948 - 35911743
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnna-gaaaatcgtccttgcaaaacattttgtt |
175 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||| ||||||||| | |||| ||||| ||||| ||||||| |||| || |
|
|
| T |
35911948 |
aggctaaaatatgcttttggtccctgcaaatatagcgaatttggattttggtccttggtaaaaaaaaaatttgaaaaacgtccctgcaaaaatttttatt |
35911849 |
T |
 |
| Q |
176 |
tttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtggcatccaggt |
275 |
Q |
| |
|
||| ||||| |||| ||| |||||||| | | ||||||||| ||||| ||| || ||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35911848 |
ttttaaaatggtccctggtcccactttttcgatgatttgtcacatttatgcatacttggcagatgctgacggtgcaaacatgtacatgtggcatccaggt |
35911749 |
T |
 |
| Q |
276 |
ggcaat |
281 |
Q |
| |
|
|||||| |
|
|
| T |
35911748 |
ggcaat |
35911743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 78 - 281
Target Start/End: Original strand, 24609919 - 24610123
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnna-gaaaatcgtccttgcaaaacattttgttt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | || |||||||||||||||||| |||| ||| || ||| ||||||| |||||||| |
|
|
| T |
24609919 |
ggctaaaatatgtttttggtccctgcaaatatggcgagtttgggttttggtccctagtaaataaattttttgaatttcatccctgcaaaattttttgttt |
24610018 |
T |
 |
| Q |
177 |
ttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtggcatccaggtg |
276 |
Q |
| |
|
|| |||||||||| | | |||||||| ||| ||||||||| ||||| ||| |||||||||| ||||| | | ||||| ||||||||||||||||| ||| |
|
|
| T |
24610019 |
tttaaaatagtccctcgccccacttttttggtgatttgtcacatttgtgcatatgtggcatgagctgattgtacaaacttgtacatgtggcatccatgtg |
24610118 |
T |
 |
| Q |
277 |
gcaat |
281 |
Q |
| |
|
||||| |
|
|
| T |
24610119 |
gcaat |
24610123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 77 - 214
Target Start/End: Original strand, 26863859 - 26863997
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaa-nnnnnnnnagaaaatcgtccttgcaaaacattttgtt |
175 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||| |||||||||||| |||| ||||||| ||| ||||||| ||||||| |
|
|
| T |
26863859 |
aggctaaaatgtgtttttggtccctgcaaatatagcgaatttgagttttggtccctggtaaattttttttttgaaaatcatccctgcaaaaatttttgtt |
26863958 |
T |
 |
| Q |
176 |
tttaaaaatagtccttgggcccactttcttgttgatttg |
214 |
Q |
| |
|
||| ||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
26863959 |
ttttaaaatagtccttgggcccactttattgctgatttg |
26863997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 77 - 246
Target Start/End: Complemental strand, 24611177 - 24611007
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaat-aaannnnnnnnagaaaatcgtccttgcaaaacattttgtt |
175 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| || |||| |||||||||||| | ||| ||| || ||| ||||||| ||||||| |
|
|
| T |
24611177 |
aggctaaaatatgtttttggtccctgtaaatatgacgagtttgagttttggtccctggtaaaataaaattttgaatttcatccctgcaaaaatttttgtt |
24611078 |
T |
 |
| Q |
176 |
tttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgact |
246 |
Q |
| |
|
||| |||||||||||||| |||||||||||| ||||||||||||||| || |||||||||| |||||||| |
|
|
| T |
24611077 |
tttcaaaatagtccttggacccactttcttgatgatttgtctcatttttgtctatgtggcagctgctgact |
24611007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 30722199 - 30722285
Alignment:
| Q |
160 |
tgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgact |
246 |
Q |
| |
|
||||||| |||||||||| |||||||||| ||| |||||||||||| ||||||||||||||| |||||| |||||| ||||||||| |
|
|
| T |
30722199 |
tgcaaaattttttgttttttaaaatagtccctggacccactttcttgctgatttgtctcatttttgcctacgtggcaaatgctgact |
30722285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 77 - 132
Target Start/End: Original strand, 37395632 - 37395687
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
37395632 |
aggctaaaatatgtttttggtccctgcaaatatagcgtatttgggttttggtccct |
37395687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 76 - 132
Target Start/End: Complemental strand, 27264277 - 27264221
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
27264277 |
taggctaaaatatgattttggtccctgcaaatatagcgagtttgggttttggtccct |
27264221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 77 - 132
Target Start/End: Complemental strand, 9774948 - 9774893
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
9774948 |
aggctaaaatatgcttttggtccctgcaaatatagcgagtttgggttttggtccct |
9774893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 77 - 132
Target Start/End: Complemental strand, 20723748 - 20723693
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||| |
|
|
| T |
20723748 |
aggctaaaatatgtttttggtccctgcaaatatagcgaatttgagttttagtccct |
20723693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 77 - 132
Target Start/End: Original strand, 27262907 - 27262962
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||| |||||||||||| |
|
|
| T |
27262907 |
aggctaaaatatgtttttggtccctgcaaatatagcgagtttgtgttttggtccct |
27262962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 74 - 129
Target Start/End: Complemental strand, 35722348 - 35722293
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtc |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||| |||||||| |
|
|
| T |
35722348 |
tttaggctaaaatatgtttttggtccctgtaaatatagcgaatttggattttggtc |
35722293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 77 - 267
Target Start/End: Original strand, 47038865 - 47039056
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaat-aaannnnnnnnagaaaatcgtccttgcaaaacattttgtt |
175 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| | ||||||||||||||||| | ||| ||| | ||| ||||||| ||||||| |
|
|
| T |
47038865 |
aggctaaaatatgtttttagtccctgcaaatatagctagtttgggttttggtccctggtaaaaaaaaattttgaattccatccctgcaaaaatttttgtt |
47038964 |
T |
 |
| Q |
176 |
tttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtggc |
267 |
Q |
| |
|
||| |||||||||||||| |||||||||| ||||||||| || |||| ||| || |||||| ||| ||||| | ||| | | |||||||||| |
|
|
| T |
47038965 |
ttttaaaatagtccttggacccactttctagttgatttggctgatttttgcttaggtggcagatgttgactgtacaatcttatacatgtggc |
47039056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 78 - 124
Target Start/End: Complemental strand, 11711312 - 11711266
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11711312 |
ggctaaaatatgtttttggtccctgcaaatatagcgaatttgggttt |
11711266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 78 - 132
Target Start/End: Original strand, 20722472 - 20722526
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||| || ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20722472 |
ggctaaaatgtgcttttggtccctgcaaatatagcgaatttgggttttggtccct |
20722526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 77 - 127
Target Start/End: Complemental strand, 45979556 - 45979506
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttgg |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
45979556 |
aggctaaaatatgtttttggtccctgcaaatatagcgaatttgagttttgg |
45979506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 78 - 132
Target Start/End: Complemental strand, 46075109 - 46075055
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||||||||||||||| |
|
|
| T |
46075109 |
ggctaaaatatgtttttgatccctgcaaatatagcgagtttgggttttggtccct |
46075055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 77 - 130
Target Start/End: Complemental strand, 17977619 - 17977566
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtcc |
130 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17977619 |
aggcttaaatatggttttggtccctgcaaatatagcgaatttgggttttggtcc |
17977566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 74 - 126
Target Start/End: Complemental strand, 2604190 - 2604138
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttg |
126 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||| ||||||||||| |
|
|
| T |
2604190 |
tttaggctaaaatatgtttttagtccctgcaaatatggggagtttgggttttg |
2604138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 77 - 137
Target Start/End: Complemental strand, 48589021 - 48588961
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataa |
137 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| | || ||||||||||||||||| |||| |
|
|
| T |
48589021 |
aggctaaaatatgtttttggtccctgtaaatatggtgagtttgggttttggtccctgataa |
48588961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 78 - 132
Target Start/End: Original strand, 17976761 - 17976815
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||| ||||||| ||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
17976761 |
ggcttaaatatggttttggttcctgcaaatatagcgaatttgggttttggtccct |
17976815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 78 - 132
Target Start/End: Complemental strand, 23470028 - 23469974
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||| ||||||| ||||| |
|
|
| T |
23470028 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttcggttttgatccct |
23469974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 74 - 132
Target Start/End: Complemental strand, 39163087 - 39163029
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| | || |||||||||||||||| |
|
|
| T |
39163087 |
tttaggctaaaatatgcttttggtccctgcaaatatggcgaggttgggttttggtccct |
39163029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 83 - 132
Target Start/End: Complemental strand, 27816774 - 27816725
Alignment:
| Q |
83 |
aaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27816774 |
aaatatggttttggtccctgcaaatatagccaatttgggttttggtccct |
27816725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 80 - 137
Target Start/End: Original strand, 51240121 - 51240178
Alignment:
| Q |
80 |
ctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataa |
137 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||| ||||| ||||| |||| |
|
|
| T |
51240121 |
ctaaaatatgtttttggtctctgcaaatatagcgaatttggattttgatccctgataa |
51240178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 76 - 132
Target Start/End: Original strand, 46073883 - 46073939
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||| |||||||||||| |||||| |
|
|
| T |
46073883 |
taggctaaaatatgcttttgatccctgcaaatatagcaaatttgggttttagtccct |
46073939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 76 - 128
Target Start/End: Complemental strand, 48334193 - 48334141
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggt |
128 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||| ||||||| |||||||| |
|
|
| T |
48334193 |
taggctaaaatatgcttttggtccctacaaatatagcgaatttgagttttggt |
48334141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 77 - 137
Target Start/End: Complemental strand, 48594108 - 48594048
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataa |
137 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| | || ||||||||||| ||||| |||| |
|
|
| T |
48594108 |
aggctaaaatatgtttttggtccctgtaaatatggcgagtttgggttttgatccctgataa |
48594048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 77 - 137
Target Start/End: Complemental strand, 48598719 - 48598659
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataa |
137 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| | || ||||||||||| ||||| |||| |
|
|
| T |
48598719 |
aggctaaaatatgtttttggtccctgtaaatatggcgagtttgggttttgatccctgataa |
48598659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 81 - 132
Target Start/End: Original strand, 9774040 - 9774091
Alignment:
| Q |
81 |
taaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||| |||||||||||| |
|
|
| T |
9774040 |
taaaatatgtttttggtccctgcaaatataacgagtttgagttttggtccct |
9774091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 77 - 132
Target Start/End: Original strand, 27815440 - 27815495
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||| ||||||| || |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27815440 |
aggcttaaatatggttctggtccctgcaaatatagccaatttgggttttggtccct |
27815495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 78 - 132
Target Start/End: Complemental strand, 26865243 - 26865189
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||| |||||||| |||| |||||| |
|
|
| T |
26865243 |
ggctaaaatatatttttggtctctgcaaatatagcgaatttggattttagtccct |
26865189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 75 - 132
Target Start/End: Complemental strand, 30724077 - 30724020
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| |||||| |||||||||||| |
|
|
| T |
30724077 |
ttaggctaaaatatgcttttcgtccctgcaaatataacaaatttgagttttggtccct |
30724020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 77 - 130
Target Start/End: Original strand, 50164402 - 50164455
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtcc |
130 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| | || |||| |||||||||| |
|
|
| T |
50164402 |
aggctaaaatatgcttttggtccctgcaaatatggcgagtttgagttttggtcc |
50164455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Original strand, 10887229 - 10887264
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10887229 |
tttaggctaaaatatggttttggtccctgcaaatat |
10887264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 77 - 132
Target Start/End: Original strand, 11710552 - 11710607
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| || |||||||||||||||| |
|
|
| T |
11710552 |
aggctaaaatatgtttttgatccctgtaaatataacgaggttgggttttggtccct |
11710607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Original strand, 15516578 - 15516613
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15516578 |
tttaggctaaaatatggttttggtccctgcaaatat |
15516613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 360 - 399
Target Start/End: Original strand, 24426181 - 24426220
Alignment:
| Q |
360 |
ttttaatatattaaaaacagaatatccttccatttcaccc |
399 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
24426181 |
ttttaatatattaaaaatagaatctccttccatttcaccc |
24426220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Complemental strand, 30323297 - 30323262
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30323297 |
tttaggctaaaatatgattttggtccctgcaaatat |
30323262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Original strand, 45380268 - 45380303
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45380268 |
tttaggctaaaatatggttttggtccctgcaaatat |
45380303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 75 - 109
Target Start/End: Original strand, 8140431 - 8140465
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8140431 |
ttaggctaaaatatggttttggtccctgcaaatat |
8140465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 75 - 109
Target Start/End: Complemental strand, 10887601 - 10887567
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10887601 |
ttaggctaaaatatggttttggtccctgcaaatat |
10887567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 20723664 - 20723578
Alignment:
| Q |
160 |
tgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgact |
246 |
Q |
| |
|
||||||| |||||||||| ||||||||||||| |||||||| || ||||||| | ||||| ||| ||||||||| |||||||| |
|
|
| T |
20723664 |
tgcaaaattttttgttttttaaaatagtccttgaccccactttactgatgatttggcccatttttgcatatgtggcaggtgctgact |
20723578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 156 - 246
Target Start/End: Complemental strand, 23469949 - 23469859
Alignment:
| Q |
156 |
tccttgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgact |
246 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| | | ||||||| ||| ||||||| | ||||| ||| |||||||||| ||||||| |
|
|
| T |
23469949 |
tccttgcaaaattttttgttttttaaaatagtccctagccccacttcattgatgatttggcgcatttttgcatatgtggcattagctgact |
23469859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 75 - 109
Target Start/End: Complemental strand, 45638897 - 45638863
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45638897 |
ttaggctaaaatatggttttggtccctgcaaatat |
45638863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 12360601 - 12360634
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
12360601 |
taggctaaaatatggttttggtccctgcaaatat |
12360634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 16026940 - 16026907
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
16026940 |
taggctaaaatatggttttggtccctgcaaatat |
16026907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 26324583 - 26324616
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
26324583 |
taggctaaaatatgattttggtccctgcaaatat |
26324616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 32035790 - 32035757
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
32035790 |
taggctaaaatatggttttggtccctgcaaatat |
32035757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 35056896 - 35056863
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
35056896 |
taggctaaaatatgattttggtccctgcaaatat |
35056863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 36912851 - 36912884
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
36912851 |
taggctaaaatatggttttggtccctgcaaatat |
36912884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 39747837 - 39747804
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
39747837 |
taggctaaaatatggttttggtccctgcaaatat |
39747804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 42482977 - 42483010
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
42482977 |
taggctaaaatatggttttggtccctgcaaatat |
42483010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 47819230 - 47819263
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
47819230 |
taggctaaaatatggttttggtccctgcaaatat |
47819263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 169 - 214
Target Start/End: Original strand, 48856302 - 48856347
Alignment:
| Q |
169 |
ttttgtttttaaaaatagtccttgggcccactttcttgttgatttg |
214 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| ||| ||||||| |
|
|
| T |
48856302 |
ttttgttttttaaaatagtccttggccccactttattgatgatttg |
48856347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 72 - 109
Target Start/End: Complemental strand, 50429215 - 50429178
Alignment:
| Q |
72 |
tctttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
50429215 |
tctttaggctaaaatatgattttagtccctgcaaatat |
50429178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 3247197 - 3247229
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
3247197 |
aggctaaaatatggttttggtccctgcaaatat |
3247229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 7867358 - 7867326
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
7867358 |
aggctaaaatatggttttggtccctgcaaatat |
7867326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 10631529 - 10631497
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
10631529 |
aggctaaaatatggttttggtccctgcaaatat |
10631497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 12360969 - 12360937
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
12360969 |
aggctaaaatatggttttggtccctgcaaatat |
12360937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 78 - 130
Target Start/End: Original strand, 13074121 - 13074173
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtcc |
130 |
Q |
| |
|
||||||||||| | |||||| |||||||||||| ||||||| |||||||||| |
|
|
| T |
13074121 |
ggctaaaatattctcttggtctctgcaaatatagcgaatttgagttttggtcc |
13074173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 15526363 - 15526331
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
15526363 |
aggctaaaatatggttttggtccctgcaaatat |
15526331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 19720711 - 19720743
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
19720711 |
aggctaaaatatggttttggtccctgcaaatat |
19720743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 24507844 - 24507812
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
24507844 |
aggctaaaatatggttttggtccctgcaaatat |
24507812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 24654168 - 24654136
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
24654168 |
aggctaaaatatggttttggtccctgcaaatat |
24654136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 30322928 - 30322960
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
30322928 |
aggctaaaatatggttttggtccctgcaaatat |
30322960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 33000670 - 33000638
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
33000670 |
aggctaaaatatggttttggtccctgcaaatat |
33000638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 33045691 - 33045659
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
33045691 |
aggctaaaatatggttttggtccctgcaaatat |
33045659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 33234545 - 33234577
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
33234545 |
aggctaaaatatggttttggtccctgcaaatat |
33234577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 76 - 132
Target Start/End: Original strand, 35910651 - 35910706
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||| |||| ||||||||||||| |
|
|
| T |
35910651 |
taggctaaaatatgattttggt-cctgcaaatatagcatatttcggttttggtccct |
35910706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 38164296 - 38164264
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
38164296 |
aggctaaaatatggttttggtccctgcaaatat |
38164264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 42483272 - 42483240
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
42483272 |
aggctaaaatatggttttggtccctgcaaatat |
42483240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 47819597 - 47819565
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
47819597 |
aggctaaaatatggttttggtccctgcaaatat |
47819565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 71; Significance: 7e-32; HSPs: 74)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 79 - 269
Target Start/End: Complemental strand, 31489993 - 31489803
Alignment:
| Q |
79 |
gctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnnagaaaatcgtccttgcaaaacattttgttttt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||||||| || |||| ||||||||| |||||| |||| ||||| |
|
|
| T |
31489993 |
gctaaaatatgtttttggtccctgcaaatataacgagtttgggttttggtccttagtaaaaaaaaaattgaaaatcgttattgcaattttttttattttt |
31489894 |
T |
 |
| Q |
179 |
aaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtggcat |
269 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||| ||||||||||||||||||| ||| ||||||| |||||||||||||| |
|
|
| T |
31489893 |
taaaatagtccccaaacccactttcttgctgatttgtctcatttttgcctatgtggcatatgctaactctgcaaacctgtacatgtggcat |
31489803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 75 - 281
Target Start/End: Complemental strand, 32197971 - 32197763
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnna--gaaaatcgtccttgcaaaacatttt |
172 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| | |||| ||||| ||||| ||||||| |||| |
|
|
| T |
32197971 |
ttaggctaaaatatgcttttggtccctgcaaatatagcgaatttgggttttggtccttggtaaaaaaaaaattttgaaaagcgtccctgcaaaatttttt |
32197872 |
T |
 |
| Q |
173 |
gtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtggcatcca |
272 |
Q |
| |
|
|||||| |||||||||| ||| |||| ||| | | ||||||||| ||||| ||| || ||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
32197871 |
gttttttaaaatagtccctggtcccattttttcgatgatttgtcacatttatgcatacttggcagatgctgacggtgcaaacatgtacatgtggcatcca |
32197772 |
T |
 |
| Q |
273 |
ggtggcaat |
281 |
Q |
| |
|
|||| |||| |
|
|
| T |
32197771 |
ggtgacaat |
32197763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 169 - 277
Target Start/End: Complemental strand, 39619760 - 39619652
Alignment:
| Q |
169 |
ttttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtggca |
268 |
Q |
| |
|
|||||||||| |||||||||||||| | ||||||||| ||||||||| ||||| ||| |||||||||| ||||||||||||||| |||||||||| || |
|
|
| T |
39619760 |
ttttgttttttaaaatagtccttggactcactttcttaatgatttgtcacatttgtgcatatgtggcattagctgactatgcaaacttgtacatgtgtca |
39619661 |
T |
 |
| Q |
269 |
tccaggtgg |
277 |
Q |
| |
|
|||| |||| |
|
|
| T |
39619660 |
tccatgtgg |
39619652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 77 - 214
Target Start/End: Original strand, 24195606 - 24195746
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccc---taataaannnnnnnnagaaaatcgtccttgcaaaacattttg |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||| |||| ||| ||| |||| | ||||||||||| ||||| |
|
|
| T |
24195606 |
aggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttgctccctggtaaaaaaaaaaaaattgaaatccatccttgcaaaattttttg |
24195705 |
T |
 |
| Q |
174 |
tttttaaaaatagtccttgggcccactttcttgttgatttg |
214 |
Q |
| |
|
||||| |||| ||||||||| |||||||||||||||||||| |
|
|
| T |
24195706 |
ttttttaaaaaagtccttggccccactttcttgttgatttg |
24195746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 476 - 537
Target Start/End: Original strand, 31488943 - 31489004
Alignment:
| Q |
476 |
tcaaatcaaaattctggaaaactaaattcatcttcgtgcaagatcttcatcttcatcaattc |
537 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
31488943 |
tcaaatcaaaattctggaaaattaaattcatcttcgagcaacatcttcatcttcatcaattc |
31489004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 75 - 132
Target Start/End: Complemental strand, 31848206 - 31848149
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31848206 |
ttaggctaaaatatgtttttagtccctgcaaatatagcgaatttgggttttggtccct |
31848149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 81 - 253
Target Start/End: Complemental strand, 32544830 - 32544657
Alignment:
| Q |
81 |
taaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnn-agaaaatcgtccttgcaaaacattttgttttta |
179 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||||||| | |||| | |||| |||| || ||| |||||||||| |
|
|
| T |
32544830 |
taaaatatgattttggtccctgcaaatatagcgaatttgggttttggtccttggtaaataaaaaattaaaaaaatgtccctgtaaatttttttgtttttt |
32544731 |
T |
 |
| Q |
180 |
aaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaa |
253 |
Q |
| |
|
||||||||| ||||| | ||||||||| |||||||| | |||| ||||||||||||| ||| |||||||||||| |
|
|
| T |
32544730 |
aaaatagtcattgggtctactttcttgctgatttgtttaatttttgcctatgtggcagatgatgactatgcaaa |
32544657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 77 - 236
Target Start/End: Complemental strand, 36749307 - 36749147
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnna-gaaaatcgtccttgcaaaacattttgtt |
175 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||| ||||||||||||| |||| |||| || ||| ||||||| |||||||| |
|
|
| T |
36749307 |
aggctaaaatatgtttttggtcattgcaaatatgacgagtttgagttttggtccctagtaaatttttgttttgaaattcatccctgcaaaaaattttgtt |
36749208 |
T |
 |
| Q |
176 |
tttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggca |
236 |
Q |
| |
|
||| ||||||||| |||| ||||||||| | ||||||||||||||||||| ||||||||| |
|
|
| T |
36749207 |
ttttaaaatagtctttggatccactttctcgctgatttgtctcatttctgcatatgtggca |
36749147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 156 - 244
Target Start/End: Complemental strand, 42255882 - 42255794
Alignment:
| Q |
156 |
tccttgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctga |
244 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||| | | | |||||||||| |||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
42255882 |
tccttgcaaaatattttgttttttaaaatagtctctagacacactttcttgctgatttgtctcatttcagcctatgtggcagatgctga |
42255794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 200 - 280
Target Start/End: Original strand, 31488683 - 31488763
Alignment:
| Q |
200 |
tttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtggcatccaggtggcaa |
280 |
Q |
| |
|
||||||| ||||||||| |||||| ||| ||||||| ||||| |||||||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
31488683 |
tttcttgctgatttgtcccatttcagcccatgtggcttatgccgactatgcaaacatatacatatggcatctaggtggcaa |
31488763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 81 - 236
Target Start/End: Complemental strand, 12385763 - 12385608
Alignment:
| Q |
81 |
taaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnnagaaaatcgtccttgcaaaacattttgtttttaa |
180 |
Q |
| |
|
||||||||| ||||||||||||||||||||| || ||||| ||||||||||| |||| |||| || ||| ||||||| |||||||||| | |
|
|
| T |
12385763 |
taaaatatgattttggtccctgcaaatatagcgagtttggattttggtccctggtaaaaaaaaatttgaaattcatccctgcaaaattttttgtttttta |
12385664 |
T |
 |
| Q |
181 |
aaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggca |
236 |
Q |
| |
|
|||| |||||||| |||||||| ||| || |||| ||||||| ||||||||||| |
|
|
| T |
12385663 |
aaattgtccttggccccactttattgatgttttggtgcatttctacctatgtggca |
12385608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 77 - 132
Target Start/End: Original strand, 13418949 - 13419004
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||| ||||||||| |
|
|
| T |
13418949 |
aggctaaaatatgtttttggtccctgcaaatattgcgaatttgggtattggtccct |
13419004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 76 - 214
Target Start/End: Complemental strand, 24197164 - 24197025
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnnagaaaa-tcgtccttgcaaaacattttgt |
174 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| ||||||| |||||||| ||| |||| |||| || ||||||||||| |||||| |
|
|
| T |
24197164 |
taggctaaaatatgcttttggtccctgcaaatatagcgaatttgagttttggttcctggtaaaaaaaaattttaaaattcatccttgcaaaattttttgt |
24197065 |
T |
 |
| Q |
175 |
ttttaaaaatagtccttgggcccactttcttgttgatttg |
214 |
Q |
| |
|
|||| |||| |||| ||| |||||||||||||||||||| |
|
|
| T |
24197064 |
tttttaaaaaagtcattgaccccactttcttgttgatttg |
24197025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 169 - 236
Target Start/End: Original strand, 37784072 - 37784139
Alignment:
| Q |
169 |
ttttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggca |
236 |
Q |
| |
|
|||| ||||| |||||||||||||| || ||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
37784072 |
ttttattttttaaaatagtccttggaccaactttcttgctgatttgtctcattcctgcctatgtggca |
37784139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 77 - 132
Target Start/End: Original strand, 41693644 - 41693699
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| | |||||||||||||||||||| |
|
|
| T |
41693644 |
aggctaaaatatgtttttgatccctgcaaatatggcgaatttgggttttggtccct |
41693699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 74 - 132
Target Start/End: Complemental strand, 5611570 - 5611512
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| || |||||||||| |||||| |
|
|
| T |
5611570 |
tttaggctaaaatatgattttggtccctgcaaatatagcgagtttgggttttcgtccct |
5611512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 79 - 137
Target Start/End: Original strand, 32196685 - 32196743
Alignment:
| Q |
79 |
gctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataa |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||| ||||||||||| |||| |
|
|
| T |
32196685 |
gctaaaatatgtttttggtccctgcaaatatagcgtatttggattttggtccctgataa |
32196743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 78 - 245
Target Start/End: Original strand, 36748198 - 36748365
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnna--gaaaatcgtccttgcaaaacattttgtt |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | || |||||||||||||||| | |||| |||| || || ||||||| ||||||| |
|
|
| T |
36748198 |
ggctaaaatatgtttttggtccctgcaaatat-gagagtttgggttttggtccc-agtaaatttttttttttgaaattcatctctgcaaaattttttgtt |
36748295 |
T |
 |
| Q |
176 |
tttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgac |
245 |
Q |
| |
|
|| ||||||||| ||| |||||||| ||| ||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
36748296 |
ttctaaaatagtctctggacccacttttttgctgatttgtctcatttttgcctatgtggcagatgctgac |
36748365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 169 - 269
Target Start/End: Original strand, 39618747 - 39618847
Alignment:
| Q |
169 |
ttttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtggca |
268 |
Q |
| |
|
|||||| ||| |||||||||||||| |||||||||||| |||||||||| |||| || |||||||||| |||||| | || || || ||||||||||| |
|
|
| T |
39618747 |
ttttgtattttaaaatagtccttggacccactttcttgatgatttgtcttatttttgtctatgtggcaggtgctgattgtgtaattatatacatgtggca |
39618846 |
T |
 |
| Q |
269 |
t |
269 |
Q |
| |
|
| |
|
|
| T |
39618847 |
t |
39618847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 169 - 241
Target Start/End: Original strand, 42255050 - 42255122
Alignment:
| Q |
169 |
ttttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgc |
241 |
Q |
| |
|
|||||||||| ||||||||| |||| ||||||||||| ||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
42255050 |
ttttgttttttaaaatagtcattggatccactttcttgctgatttgtcccatttctgcatatgtggcagatgc |
42255122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 77 - 236
Target Start/End: Original strand, 554244 - 554402
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnnagaaaatcgtccttgcaaaacattttgttt |
176 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||| || |||||||||||||||| ||||| | ||| || ||| |||| | |||||||| |
|
|
| T |
554244 |
aggctaaaatataatattggtccctgcaaatatagcgagtttgggttttggtccccgataaaaaaaattta-aaattcatccatgcagatttttttgttt |
554342 |
T |
 |
| Q |
177 |
ttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggca |
236 |
Q |
| |
|
||||||||||| | | | |||||| ||||||||||||| ||||||| ||| ||||||||| |
|
|
| T |
554343 |
ttaaaaatagttcctagacccactgtcttgttgatttggctcatttttgcttatgtggca |
554402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 79 - 138
Target Start/End: Original strand, 31853549 - 31853608
Alignment:
| Q |
79 |
gctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaa |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||| | || ||||| |||||||||||| |||| |
|
|
| T |
31853549 |
gctaaaatatgtttttggtccctgcaaatattgtgagtttggattttggtccctagtaaa |
31853608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 77 - 132
Target Start/End: Original strand, 35212067 - 35212122
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
35212067 |
aggctaaaatatgtttttggtccctgcaaatatgacgagtttgggttttggtccct |
35212122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 74 - 132
Target Start/End: Original strand, 17066421 - 17066479
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| || ||||||||||||||||| |
|
|
| T |
17066421 |
tttaggctaaaatatgcttttaatccctgcaaatatagcgagtttgggttttggtccct |
17066479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 81 - 131
Target Start/End: Original strand, 38742184 - 38742234
Alignment:
| Q |
81 |
taaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccc |
131 |
Q |
| |
|
|||||||||||||| |||||||||||||||| || |||||||||||||||| |
|
|
| T |
38742184 |
taaaatatgtttttagtccctgcaaatatagcgagtttgggttttggtccc |
38742234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 74 - 132
Target Start/End: Complemental strand, 41695018 - 41694960
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| || |||| |||||||||||| |
|
|
| T |
41695018 |
tttaggctaaaatatgtttttcatccctgcaaatatagcgagtttgagttttggtccct |
41694960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 76 - 132
Target Start/End: Original strand, 12933417 - 12933473
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| || |||| ||||||||||| |
|
|
| T |
12933417 |
taggctaaaatatgcttttggtccctgcaaatatagtgagtttgaattttggtccct |
12933473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 84 - 132
Target Start/End: Complemental strand, 43869965 - 43869917
Alignment:
| Q |
84 |
aatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43869965 |
aatatggttttggtccctgcaaatatagccaatttgggttttggtccct |
43869917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 12932785 - 12932752
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
12932785 |
taggctaaaatatgtttttggtccctgcaaatat |
12932752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 73 - 138
Target Start/End: Original strand, 30512040 - 30512105
Alignment:
| Q |
73 |
ctttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaa |
138 |
Q |
| |
|
||||| |||||||||| |||||| ||| ||||||||||| ||||||| |||||||| ||| ||||| |
|
|
| T |
30512040 |
ctttaagctaaaatatatttttgttccttgcaaatatagcgaatttgagttttggtacctgataaa |
30512105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 76 - 129
Target Start/End: Original strand, 40576764 - 40576817
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtc |
129 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
40576764 |
taggctaaaatatgcttttggtccctgcaaatatgacgaatttggattttggtc |
40576817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 76 - 128
Target Start/End: Complemental strand, 39619852 - 39619800
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggt |
128 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||| | || ||||||||||||| |
|
|
| T |
39619852 |
taggctaaaatatgcttttggtccatgcaaatatggcgagtttgggttttggt |
39619800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Complemental strand, 3975842 - 3975807
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3975842 |
tttaggctaaaatatggttttggtccctgcaaatat |
3975807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 81 - 132
Target Start/End: Complemental strand, 11217127 - 11217076
Alignment:
| Q |
81 |
taaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||| ||||||||||||||||||||| || |||| ||||||||||| |
|
|
| T |
11217127 |
taaaatatgcttttggtccctgcaaatatagcgagtttgaattttggtccct |
11217076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Complemental strand, 11767279 - 11767244
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11767279 |
tttaggctaaaatatggttttggtccctgcaaatat |
11767244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Original strand, 23399608 - 23399643
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23399608 |
tttaggctaaaatatggttttggtccctgcaaatat |
23399643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Original strand, 25988381 - 25988416
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25988381 |
tttaggctaaaatatggttttggtccctgcaaatat |
25988416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Complemental strand, 35838341 - 35838306
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35838341 |
tttaggctaaaatatggttttggtccctgcaaatat |
35838306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Complemental strand, 41054240 - 41054205
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41054240 |
tttaggctaaaatatggttttggtccctgcaaatat |
41054205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 77 - 132
Target Start/End: Original strand, 42254957 - 42255012
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||| |||||||||||| |||||| | || |||| |||||||||||| |
|
|
| T |
42254957 |
aggctaaaatatgcttttggtccctgtaaatatggcgagtttgagttttggtccct |
42255012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Original strand, 46759654 - 46759689
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46759654 |
tttaggctaaaatatggttttggtccctgcaaatat |
46759689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 76 - 110
Target Start/End: Original strand, 29198301 - 29198335
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatata |
110 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
29198301 |
taggctaaaatatggttttggtccctgcaaatata |
29198335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 74 - 128
Target Start/End: Original strand, 31846982 - 31847036
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggt |
128 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
31846982 |
tttaggttaaaatatgcttttggtccctgcaaatatatctaatttggattttggt |
31847036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 1614557 - 1614590
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
1614557 |
taggctaaaatatggttttggtccctgcaaatat |
1614590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 8144660 - 8144627
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
8144660 |
taggctaaaatatggttttggtccctgcaaatat |
8144627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 23676454 - 23676421
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
23676454 |
taggctaaaatatggttttggtccctgcaaatat |
23676421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 26878073 - 26878040
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
26878073 |
taggctaaaatatggttttggtccctgcaaatat |
26878040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 28262711 - 28262744
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
28262711 |
taggctaaaatatggttttggtccctgcaaatat |
28262744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 29198664 - 29198631
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
29198664 |
taggctaaaatatggttttggtccctgcaaatat |
29198631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 77 - 110
Target Start/End: Original strand, 44568325 - 44568358
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatata |
110 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
44568325 |
aggctaaaatatggttttggtccctgcaaatata |
44568358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 48192490 - 48192457
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
48192490 |
taggctaaaatatggttttggtccctgcaaatat |
48192457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 1614905 - 1614873
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
1614905 |
aggctaaaatatggttttggtccctgcaaatat |
1614873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 2945846 - 2945814
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
2945846 |
aggctaaaatatgtttttggtccctacaaatat |
2945814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 3975548 - 3975580
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
3975548 |
aggctaaaatatggttttggtccctgcaaatat |
3975580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 5233807 - 5233839
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
5233807 |
aggctaaaatatggttttggtccctgcaaatat |
5233839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 81 - 125
Target Start/End: Original strand, 5610159 - 5610203
Alignment:
| Q |
81 |
taaaatatgtttttggtccctgcaaatatagggaatttgggtttt |
125 |
Q |
| |
|
||||||||| ||||| |||||||||||||| ||||||||||||| |
|
|
| T |
5610159 |
taaaatatgcttttgatccctgcaaatataacgaatttgggtttt |
5610203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 8144294 - 8144326
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
8144294 |
aggctaaaatatggttttggtccctgcaaatat |
8144326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 9659690 - 9659658
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
9659690 |
aggctaaaatatggttttggtccctgcaaatat |
9659658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 14543709 - 14543741
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
14543709 |
aggctaaaatatggttttggtccctgcaaatat |
14543741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 23399977 - 23399945
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
23399977 |
aggctaaaatatggttttggtccctgcaaatat |
23399945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 74 - 130
Target Start/End: Complemental strand, 25046303 - 25046247
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtcc |
130 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||| | || ||| | ||||||||| |
|
|
| T |
25046303 |
tttaggctaaaatatgattttggtccttgcaaatatggcgagtttagattttggtcc |
25046247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 25092159 - 25092191
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
25092159 |
aggctaaaatatggttttggtccctgcaaatat |
25092191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 25092549 - 25092517
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
25092549 |
aggctaaaatatggttttggtccctgcaaatat |
25092517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 25988750 - 25988718
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
25988750 |
aggctaaaatatggttttggtccctgcaaatat |
25988718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 27458398 - 27458430
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
27458398 |
aggctaaaatatggttttggtccctgcaaatat |
27458430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 80 - 132
Target Start/End: Complemental strand, 28462685 - 28462633
Alignment:
| Q |
80 |
ctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||||||||||||| ||||| |
|
|
| T |
28462685 |
ctaaaatatgcttttggtctctgcaaatatgacgaatttgggttttgatccct |
28462633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 35837923 - 35837955
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
35837923 |
aggctaaaatatggttttggtccctgcaaatat |
35837955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 36687264 - 36687232
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
36687264 |
aggctaaaatatgattttggtccctgcaaatat |
36687232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 170 - 234
Target Start/End: Complemental strand, 36892876 - 36892812
Alignment:
| Q |
170 |
tttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtgg |
234 |
Q |
| |
|
||||||||| ||||||||| |||| ||||||| || ||||||||| |||||||||||| |||| |
|
|
| T |
36892876 |
tttgttttttaaaatagtcattggccccacttatttactgatttgtcacatttctgcctacgtgg |
36892812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 41053841 - 41053873
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
41053841 |
aggctaaaatatggttttggtccctgcaaatat |
41053873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 76 - 128
Target Start/End: Original strand, 43065999 - 43066051
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggt |
128 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| || |||| |||||||| |
|
|
| T |
43065999 |
taggttaaaatatgttttttatccctgcaaatatagcgagtttgagttttggt |
43066051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 45228919 - 45228887
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
45228919 |
aggctaaaatatggttttggtccctgcaaatat |
45228887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 46828943 - 46828975
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
46828943 |
aggctaaaatatggttttggtccctgcaaatat |
46828975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 48852443 - 48852475
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
48852443 |
aggctaaaatatggttttggtccctgcaaatat |
48852475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0517 (Bit Score: 68; Significance: 4e-30; HSPs: 2)
Name: scaffold0517
Description:
Target: scaffold0517; HSP #1
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 78 - 276
Target Start/End: Original strand, 10315 - 10514
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnna-gaaaatcgtccttgcaaaacattttgttt |
176 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||| |||||||||| | |||| ||||| ||||| ||||||| |||||||| |
|
|
| T |
10315 |
ggctaaaatatgcttttggtccctgcaaatatagcgaatttgagttttggtccttggtaaaaaaattttttgaaaaacgtccctgcaaaattttttgttt |
10414 |
T |
 |
| Q |
177 |
ttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtggcatccaggtg |
276 |
Q |
| |
|
|| |||||||||| ||| |||||||| | | ||||||||| ||||| ||| || ||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10415 |
tttaaaatagtccctggtcccactttttcgatgatttgtcacatttatgcatacttggcagatgctgacggtgcaaacatgtacatgtggcatccaggtg |
10514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0517; HSP #2
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 77 - 132
Target Start/End: Complemental strand, 11582 - 11527
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
11582 |
aggctaaaatatgtttttggtccctgcaaatatagcgtatttgggttttggtccct |
11527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 65; Significance: 3e-28; HSPs: 91)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 169 - 277
Target Start/End: Complemental strand, 52403090 - 52402982
Alignment:
| Q |
169 |
ttttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtggca |
268 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||| ||||||||| ||||| ||| |||||||||| ||||||||||||||| |||||||||| || |
|
|
| T |
52403090 |
ttttgttttttaaaatagtccttggacccactttcttgatgatttgtcacatttgtgcatatgtggcattagctgactatgcaaacttgtacatgtgtca |
52402991 |
T |
 |
| Q |
269 |
tccaggtgg |
277 |
Q |
| |
|
|||| |||| |
|
|
| T |
52402990 |
tccatgtgg |
52402982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 76 - 246
Target Start/End: Original strand, 42446524 - 42446695
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnna-gaaaatcgtccttgcaaaacattttgt |
174 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| | || |||||||||||||| || |||| |||| || ||| ||||||| ||||||| |
|
|
| T |
42446524 |
taggctaaaatatgcttttggtccctgcaaatatggcgagtttgggttttggtcgatagtaaaagaaatttttgaaattcatccctgcaaaaaattttgt |
42446623 |
T |
 |
| Q |
175 |
ttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgact |
246 |
Q |
| |
|
|||| |||||||||||| | |||| |||||||||||||||||| ||||| |||||||||||| ||||||||| |
|
|
| T |
42446624 |
tttttaaaatagtcctttgacccaatttcttgttgatttgtcttatttcagcctatgtggcagatgctgact |
42446695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 42447763 - 42447677
Alignment:
| Q |
160 |
tgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgact |
246 |
Q |
| |
|
||||||| |||||||||| |||||||||||||| |||||||||||| ||||||||| ||||| |||||||||| || ||||||||| |
|
|
| T |
42447763 |
tgcaaaattttttgttttttaaaatagtccttggacccactttcttgctgatttgtcccatttttgcctatgtgacagatgctgact |
42447677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 76 - 133
Target Start/End: Complemental strand, 54437528 - 54437471
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtcccta |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
54437528 |
taggctaaaatatgtttttggtccctgcaaatatagcgaatttgagttttggtcccta |
54437471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 74 - 133
Target Start/End: Original strand, 46026072 - 46026131
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtcccta |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||| |
|
|
| T |
46026072 |
tttaggctaaaatatgtttttggtccctgcaaatatagcgagtttggattttggtcccta |
46026131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 75 - 132
Target Start/End: Complemental strand, 47433871 - 47433814
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
47433871 |
ttaggctaaaatatggttttggtccctgcaaatatagcgaatttgagttttggtccct |
47433814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 80 - 132
Target Start/End: Original strand, 20488368 - 20488420
Alignment:
| Q |
80 |
ctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
20488368 |
ctaaaatatgtttttggtccctgcaaatatggtgaatttgggttttggtccct |
20488420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 76 - 132
Target Start/End: Complemental strand, 39820665 - 39820609
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
39820665 |
taggctaaaatatggttttggtccctgcaaatatagcgagtttgggttttggtccct |
39820609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 77 - 132
Target Start/End: Original strand, 52401016 - 52401071
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | || ||||||||||||||||| |
|
|
| T |
52401016 |
aggctaaaatatgtttttggtccctgcaaatatggcgagtttgggttttggtccct |
52401071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 77 - 132
Target Start/End: Original strand, 53121301 - 53121356
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||| |||||| |
|
|
| T |
53121301 |
aggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccct |
53121356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 74 - 132
Target Start/End: Complemental strand, 20585707 - 20585649
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| || ||||| ||||||||||| |
|
|
| T |
20585707 |
tttaggctaaaatatgtttttgatccctgcaaatatagcgagtttggattttggtccct |
20585649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 74 - 132
Target Start/End: Complemental strand, 52403187 - 52403129
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| | || ||||||||||||||||| |
|
|
| T |
52403187 |
tttaggctaaaatatgcttttggtccctgcaaatatggcgagtttgggttttggtccct |
52403129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 75 - 137
Target Start/End: Original strand, 52707533 - 52707595
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataa |
137 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||| ||||||| |||||||||||| |||| |
|
|
| T |
52707533 |
ttaggttaaaatatgtttttggtccttgcaaatatagcgaatttgagttttggtccctgataa |
52707595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 77 - 133
Target Start/End: Complemental strand, 40477434 - 40477378
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtcccta |
133 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
40477434 |
aggctaaaatatgattttggtccctgcaaatataacgagtttgggttttggtcccta |
40477378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 78 - 281
Target Start/End: Original strand, 43641143 - 43641347
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaat-aaannnnnnnnagaaaatcgtccttgcaaaacattttgttt |
176 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| || ||||| || |||||||| | ||| ||||| ||||||||||||| || ||||| |
|
|
| T |
43641143 |
ggctaaaatatgcttttagtccctgcaaatatagcgagtttggattatggtccctggtaaaaaaaagttttgaaaaacgtccttgcaaaattttatgttt |
43641242 |
T |
 |
| Q |
177 |
ttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtggcatccaggtg |
276 |
Q |
| |
|
|| |||||||||| || | |||||||||||||||||| | ||||| | |||||| | |||||||| || |||| |||| |||||||||||| ||| |
|
|
| T |
43641243 |
tttaaaatagtccctgatctcactttcttgttgatttggcacattttctctcatgtggtaggtgctgactgtgtaaacttgtatatgtggcatccaagtg |
43641342 |
T |
 |
| Q |
277 |
gcaat |
281 |
Q |
| |
|
||||| |
|
|
| T |
43641343 |
gcaat |
43641347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 79 - 138
Target Start/End: Original strand, 40476222 - 40476281
Alignment:
| Q |
79 |
gctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaa |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||| |||||||| ||| |||| |
|
|
| T |
40476222 |
gctaaaatatgtttttggtccctgcaaatatagcgagtttggattttggtctctagtaaa |
40476281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 76 - 246
Target Start/End: Original strand, 51004140 - 51004311
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaa-nnnnnnnnagaaaatcgtccttgcaaaacattttgt |
174 |
Q |
| |
|
||||||||||||||||||| | ||||| |||||| | ||||||||||||||||||| ||||| |||| || ||| ||||||| |||||| |
|
|
| T |
51004140 |
taggctaaaatatgtttttagaccctgtaaatatggcgaatttgggttttggtcccggataaattttatttttgaaattcatccctgcaaaattttttgt |
51004239 |
T |
 |
| Q |
175 |
ttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgact |
246 |
Q |
| |
|
|||| |||||||||||| |||||||| ||| ||||||| | ||||| |||||| ||||||| ||||||| |
|
|
| T |
51004240 |
tttttaaaatagtccttaaccccactttattgatgatttggcacatttatgcctacgtggcattcgctgact |
51004311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 78 - 129
Target Start/End: Complemental strand, 52708676 - 52708625
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtc |
129 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
52708676 |
ggctaaaatatgcttttggtccctgcaaatatagcgagtttgggttttggtc |
52708625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 156 - 246
Target Start/End: Complemental strand, 32637167 - 32637077
Alignment:
| Q |
156 |
tccttgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgact |
246 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||| || |||||||| ||| ||||||| | ||||| ||| |||||||||| ||||||| |
|
|
| T |
32637167 |
tccttgcaaaatattttgttttttaaaatagtccctgaccccactttattgatgatttggcgcatttttgcatatgtggcattagctgact |
32637077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 74 - 132
Target Start/End: Complemental strand, 45268633 - 45268575
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||| |
|
|
| T |
45268633 |
tttaggctaaaatatgtttttaatccctgcaaatatagcaagtttgggttttggtccct |
45268575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 156 - 245
Target Start/End: Complemental strand, 3263332 - 3263243
Alignment:
| Q |
156 |
tccttgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgac |
245 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| | |||||||||||| | ||||| | || |||||||||||||||| |||||||| |
|
|
| T |
3263332 |
tccttgcaaaattttttgttttttaaaatagtccctaaccccactttcttgcttatttggcacagttctgcctatgtggcagatgctgac |
3263243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 79 - 132
Target Start/End: Complemental strand, 20489416 - 20489363
Alignment:
| Q |
79 |
gctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
20489416 |
gctaaaatatgtttttggtccctgcaaatatgacgagtttgggttttggtccct |
20489363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 79 - 132
Target Start/End: Original strand, 45267306 - 45267359
Alignment:
| Q |
79 |
gctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||| |||||||||||| |
|
|
| T |
45267306 |
gctaaaatatgtttttgatccctgcaaatatagcgagtttgagttttggtccct |
45267359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 169 - 259
Target Start/End: Complemental strand, 20585491 - 20585401
Alignment:
| Q |
169 |
ttttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgta |
259 |
Q |
| |
|
|||||||||| |||| |||| || |||||||||||| ||||||| ||||||| ||| |||||||||| |||||||| | ||||| |||| |
|
|
| T |
20585491 |
ttttgttttttaaaaaggtccctgaacccactttcttgctgatttgactcatttttgcttatgtggcatgtgctgactgtacaaacttgta |
20585401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 76 - 130
Target Start/End: Original strand, 22508733 - 22508787
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtcc |
130 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||| || |||| |||||||||| |
|
|
| T |
22508733 |
taggttaaaatatgattttggtccctgcaaatatagcgagtttgagttttggtcc |
22508787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 77 - 214
Target Start/End: Complemental strand, 46027477 - 46027339
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnnagaaaatcg-tccttgcaaaacattttgtt |
175 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| || |||| ||||||||||| |||| |||||| ||||||||||| | |||||| |
|
|
| T |
46027477 |
aggctaaaatatacttttggtccctgcaaatatagcgagtttgaattttggtccctggtaaaaaaaagttttgaaatcggtccttgcaaaaaaatttgtt |
46027378 |
T |
 |
| Q |
176 |
tttaaaaatagtccttgggcccactttcttgttgatttg |
214 |
Q |
| |
|
||| |||| ||||| || ||||||||||||| ||||||| |
|
|
| T |
46027377 |
ttttaaaacagtccctgagcccactttcttgctgatttg |
46027339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 78 - 132
Target Start/End: Original strand, 46104343 - 46104397
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| || |||| ||||| |||||| |
|
|
| T |
46104343 |
ggctaaaatatgattttggtccctgcaaatatagcgagtttgagtttttgtccct |
46104397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 78 - 132
Target Start/End: Original strand, 48033058 - 48033112
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| | || ||||| ||||||||||| |
|
|
| T |
48033058 |
ggctaaaatatgtttttggtccttgcaaatatggtgagtttggattttggtccct |
48033112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 75 - 132
Target Start/End: Original strand, 976777 - 976834
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||| |||||| ||||| |||||| |
|
|
| T |
976777 |
ttaggctaaaatatgcttttgatccctgcaaatatagcgaatttaagttttagtccct |
976834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 156 - 237
Target Start/End: Original strand, 32635673 - 32635754
Alignment:
| Q |
156 |
tccttgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcat |
237 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||| | | |||||||| ||| ||||||| | ||||| | | |||||||||| |
|
|
| T |
32635673 |
tccttgcaaaatattttgttttttaaaatagtccatagccccactttattgatgatttggcgcatttttacatatgtggcat |
32635754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 74 - 131
Target Start/End: Complemental strand, 38505642 - 38505585
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccc |
131 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||| | || |||| ||||||||||| |
|
|
| T |
38505642 |
tttaggctaaaatatgcttttgctccctgcaaatatggcgagtttgagttttggtccc |
38505585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 78 - 138
Target Start/End: Original strand, 9855178 - 9855238
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaa |
138 |
Q |
| |
|
|||||||||||| ||||| |||||| |||||||| || ||||| |||||||||||| |||| |
|
|
| T |
9855178 |
ggctaaaatatgattttgatccctgtaaatatagcgagtttggattttggtccctagtaaa |
9855238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 81 - 125
Target Start/End: Complemental strand, 15782765 - 15782721
Alignment:
| Q |
81 |
taaaatatgtttttggtccctgcaaatatagggaatttgggtttt |
125 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
15782765 |
taaaatatgtttttggtccctacaaatatagcgaatttgagtttt |
15782721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Original strand, 12740903 - 12740938
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12740903 |
tttaggctaaaatatggttttggtccctgcaaatat |
12740938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 75 - 110
Target Start/End: Complemental strand, 20405226 - 20405191
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaatata |
110 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20405226 |
ttaggctaaaatatggttttggtccctgcaaatata |
20405191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 77 - 132
Target Start/End: Original strand, 32635593 - 32635648
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||| ||||| |||| || |||||||| || ||||||||||||||||| |
|
|
| T |
32635593 |
aggctaaaatatattttttgtccttgtaaatatagcgagtttgggttttggtccct |
32635648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Complemental strand, 39132910 - 39132875
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39132910 |
tttaggctaaaatatggttttggtccctgcaaatat |
39132875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Original strand, 40545560 - 40545595
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40545560 |
tttaggctaaaatatggttttggtccctgcaaatat |
40545595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 77 - 128
Target Start/End: Complemental strand, 44507859 - 44507808
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggt |
128 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| || |||| ||||||| |
|
|
| T |
44507859 |
aggctaaaatatgattttggtccctgcaaatatagcgagtttgaattttggt |
44507808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Complemental strand, 47005523 - 47005488
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47005523 |
tttaggctaaaatatggttttggtccctgcaaatat |
47005488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Complemental strand, 51550450 - 51550415
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51550450 |
tttaggctaaaatatggttttggtccctgcaaatat |
51550415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Original strand, 52342191 - 52342226
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52342191 |
tttaggctaaaatatggttttggtccctgcaaatat |
52342226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 78 - 132
Target Start/End: Original strand, 4705681 - 4705735
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||| | || ||| ||||||||||||| |
|
|
| T |
4705681 |
ggctaaaatatgcttttgatccctgcaaatatggcgagtttaggttttggtccct |
4705735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 4705766 - 4705852
Alignment:
| Q |
160 |
tgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgact |
246 |
Q |
| |
|
||||||| |||||||||| |||||||||||||| || ||||| || ||||||| | ||||| |||||| ||||||| ||||||| |
|
|
| T |
4705766 |
tgcaaaattttttgttttttaaaatagtccttggcccaactttactgatgatttggcacatttatgcctacgtggcattcgctgact |
4705852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 82 - 128
Target Start/End: Complemental strand, 11914888 - 11914842
Alignment:
| Q |
82 |
aaaatatgtttttggtccctgcaaatatagggaatttgggttttggt |
128 |
Q |
| |
|
||||| || |||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
11914888 |
aaaatgtgcttttagtccctgcaaatatagcgaatttgggttttggt |
11914842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 79 - 109
Target Start/End: Original strand, 14788441 - 14788471
Alignment:
| Q |
79 |
gctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14788441 |
gctaaaatatgtttttggtccctgcaaatat |
14788471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 75 - 109
Target Start/End: Complemental strand, 28552386 - 28552352
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28552386 |
ttaggctaaaatatggttttggtccctgcaaatat |
28552352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 76 - 110
Target Start/End: Complemental strand, 30106222 - 30106188
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatata |
110 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
30106222 |
taggctaaaatatggttttggtccctgcaaatata |
30106188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 160 - 214
Target Start/End: Original strand, 39819395 - 39819449
Alignment:
| Q |
160 |
tgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttg |
214 |
Q |
| |
|
||||||| |||||||||| |||| ||||||||| |||||||||||| ||||||| |
|
|
| T |
39819395 |
tgcaaaattttttgtttttcaaaaaagtccttggccccactttcttgctgatttg |
39819449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 168 - 246
Target Start/End: Original strand, 46104428 - 46104506
Alignment:
| Q |
168 |
attttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgact |
246 |
Q |
| |
|
||||||||||| |||||||||| | |||||||||| || ||||||| | ||||| || ||||||||| ||||||||| |
|
|
| T |
46104428 |
attttgttttttaaaatagtccctaggcccactttactgatgatttggcgcattttcgcatatgtggcagatgctgact |
46104506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 474410 - 474377
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
474410 |
taggctaaaatatggttttggtccctgcaaatat |
474377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 9262157 - 9262124
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
9262157 |
taggctaaaatatggttttggtccctgcaaatat |
9262124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 9603921 - 9603888
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
9603921 |
taggctaaaatatggttttggtccctgcaaatat |
9603888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 79 - 124
Target Start/End: Original strand, 15782216 - 15782261
Alignment:
| Q |
79 |
gctaaaatatgtttttggtccctgcaaatatagggaatttgggttt |
124 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| || |||| |||| |
|
|
| T |
15782216 |
gctaaaatatatttttggtccctgcaaatatagcgagtttgagttt |
15782261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 77 - 126
Target Start/End: Original strand, 20802847 - 20802896
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttg |
126 |
Q |
| |
|
|||||||||||||||| | |||||| ||||||||| || ||||||||||| |
|
|
| T |
20802847 |
aggctaaaatatgtttctagtccctacaaatatagcgagtttgggttttg |
20802896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 28552019 - 28552052
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
28552019 |
taggctaaaatatggttttggtccctgcaaatat |
28552052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 29490745 - 29490712
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
29490745 |
taggctaaaatatggttttggtccctgcaaatat |
29490712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 79 - 128
Target Start/End: Complemental strand, 32637246 - 32637197
Alignment:
| Q |
79 |
gctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggt |
128 |
Q |
| |
|
||||||||||| |||||||||||| |||| ||| || ||||||||||||| |
|
|
| T |
32637246 |
gctaaaatatgcttttggtccctgtaaatgtagcgagtttgggttttggt |
32637197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 77 - 138
Target Start/End: Complemental strand, 41780868 - 41780807
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaa |
138 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| | ||||||||| |||||||| |||| |
|
|
| T |
41780868 |
aggctaaaatatgtttttgatccctaaaaatatagcaagtttgggtttcggtccctagtaaa |
41780807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 45002019 - 45002052
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
45002019 |
taggctaaaatatggttttggtccctgcaaatat |
45002052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 47336583 - 47336550
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
47336583 |
taggctaaaatatggttttggtccctgcaaatat |
47336550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 79 - 132
Target Start/End: Complemental strand, 48035790 - 48035737
Alignment:
| Q |
79 |
gctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||| ||||||||||||| || ||||| ||||||||||| |
|
|
| T |
48035790 |
gctaaaatatgtttttgatccctgcaaatatgacgagtttggattttggtccct |
48035737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 51550080 - 51550113
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
51550080 |
taggctaaaatatggttttggtccctgcaaatat |
51550113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 169 - 222
Target Start/End: Original strand, 52401109 - 52401162
Alignment:
| Q |
169 |
ttttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcattt |
222 |
Q |
| |
|
|||||||||| |||||||||| ||| |||||||||||| |||||| ||| |||| |
|
|
| T |
52401109 |
ttttgttttttaaaatagtccatggacccactttcttgatgatttatcttattt |
52401162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 54608865 - 54608832
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
54608865 |
taggctaaaatatggttttggtccctgcaaatat |
54608832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 474043 - 474075
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
474043 |
aggctaaaatatggttttggtccctgcaaatat |
474075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 78 - 130
Target Start/End: Complemental strand, 977905 - 977853
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtcc |
130 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
977905 |
ggctgaaatatgcttttggtccctgcaaatatgacgagtttgggttttggtcc |
977853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 1721453 - 1721421
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
1721453 |
aggctaaaatatggttttggtccctgcaaatat |
1721421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 163 - 246
Target Start/End: Original strand, 3416579 - 3416660
Alignment:
| Q |
163 |
aaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgact |
246 |
Q |
| |
|
|||| |||||||||| |||||| || ||||||||||||| ||| | || |||||||||| ||| ||||||||| ||| ||||| |
|
|
| T |
3416579 |
aaaaaattttgtttt--aaaataatcattgggcccacttttttgctcatgtgtctcatttatgcatatgtggcagatgttgact |
3416660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 3417852 - 3417820
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
3417852 |
aggctaaaatatgtttttggtccctgtaaatat |
3417820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 12741272 - 12741240
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
12741272 |
aggctaaaatatggttttggtccctgcaaatat |
12741240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 14772210 - 14772242
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
14772210 |
aggctaaaatatggttttggtccctgcaaatat |
14772242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 162 - 214
Target Start/End: Complemental strand, 15782686 - 15782634
Alignment:
| Q |
162 |
caaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttg |
214 |
Q |
| |
|
||||| ||||||||||| |||| ||| |||| |||||||||||||||||||| |
|
|
| T |
15782686 |
caaaatattttgttttttaaaaaagttcttgaccccactttcttgttgatttg |
15782634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 19844582 - 19844550
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
19844582 |
aggctaaaatatggttttggtccctgcaaatat |
19844550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 21553888 - 21553920
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
21553888 |
aggctaaaatatggttttggtccctgcaaatat |
21553920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 25615974 - 25616006
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
25615974 |
aggctaaaatatggttttggtccctgcaaatat |
25616006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 74 - 106
Target Start/End: Original strand, 30128280 - 30128312
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaa |
106 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
30128280 |
tttaggctaaaatatggttttggtccctgcaaa |
30128312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 31480135 - 31480167
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
31480135 |
aggctaaaatatggttttggtccctgcaaatat |
31480167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 32119585 - 32119553
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
32119585 |
aggctaaaatatgattttggtccctgcaaatat |
32119553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 35177254 - 35177286
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
35177254 |
aggctaaaatatgattttggtccctgcaaatat |
35177286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 76 - 128
Target Start/End: Original strand, 37845403 - 37845455
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggt |
128 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||| || |||| ||||||| |
|
|
| T |
37845403 |
taggttaaaatatgtttttggtctctgcaaatatagtgagtttgtattttggt |
37845455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 38232240 - 38232272
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
38232240 |
aggctaaaatatgattttggtccctgcaaatat |
38232272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 80 - 132
Target Start/End: Original strand, 39819314 - 39819366
Alignment:
| Q |
80 |
ctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||| |||| |||||||||||||||| || |||| ||||||||||| |
|
|
| T |
39819314 |
ctaaaatatggttttagtccctgcaaatatagcgagtttgaattttggtccct |
39819366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 81 - 109
Target Start/End: Original strand, 42444040 - 42444068
Alignment:
| Q |
81 |
taaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42444040 |
taaaatatgtttttggtccctgcaaatat |
42444068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 156 - 236
Target Start/End: Original strand, 45267384 - 45267464
Alignment:
| Q |
156 |
tccttgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggca |
236 |
Q |
| |
|
||| ||||||| |||||||||| ||||||||| | |||||||||||| ||||||||| |||| ||||||||||||| |
|
|
| T |
45267384 |
tccctgcaaaattttttgttttttgaaatagtccctatacccactttcttgatgatttgtccaatttttgcctatgtggca |
45267464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 47005153 - 47005185
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
47005153 |
aggctaaaatatggttttggtccctgcaaatat |
47005185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 47114486 - 47114518
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
47114486 |
aggctaaaatatgattttggtccctgcaaatat |
47114518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 47336227 - 47336259
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
47336227 |
aggctaaaatatggttttggtccctgcaaatat |
47336259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 169 - 237
Target Start/End: Original strand, 50563013 - 50563081
Alignment:
| Q |
169 |
ttttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcat |
237 |
Q |
| |
|
|||||||||| ||||||||| | | |||||||||||||||||||| | ||||| ||| ||||| |||| |
|
|
| T |
50563013 |
ttttgttttttaaaatagtctctagtcccactttcttgttgatttggcacatttttgcttatgtagcat |
50563081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 53113442 - 53113474
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
53113442 |
aggctaaaatatggttttggtccctgcaaatat |
53113474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 54608517 - 54608549
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
54608517 |
aggctaaaatatggttttggtccctgcaaatat |
54608549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 63; Significance: 4e-27; HSPs: 54)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 80 - 277
Target Start/End: Original strand, 17516164 - 17516362
Alignment:
| Q |
80 |
ctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnna-gaaaatcgtccttgcaaaacattttgttttt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||| | || ||||||||||||||||| ||||| ||| || || |||||| |||| ||||| |
|
|
| T |
17516164 |
ctaaaatatgtttttggtccctgcaaatatggtgagtttgggttttggtccctgataaattttttttttgaatttcatctctgcaaatttttttattttt |
17516263 |
T |
 |
| Q |
179 |
aaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtggcatccaggtgg |
277 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||| ||||| ||| |||||||||| |||||||||||||| |||||||||| |||||| |||| |
|
|
| T |
17516264 |
taaaatagtccttggacccactttcttgatgatttgtcacatttgtgcatatgtggcattaactgactatgcaaacttgtacatgtgtcatccatgtgg |
17516362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 77 - 253
Target Start/End: Complemental strand, 26421903 - 26421726
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnnagaaaatcgtccttgcaaaacattttgttt |
176 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||| ||||||| ||||| |||||| ||| ||||| |||| |||||| |||||||| |
|
|
| T |
26421903 |
aggctaaaacatgtttttggtctctgcaaatatagcgaatttgagttttagtccctggtaattttttttttgaaaaacgtctctgcaaatttttttgttt |
26421804 |
T |
 |
| Q |
177 |
ttaaaaat-agtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaa |
253 |
Q |
| |
|
|| ||||| |||| |||| ||||||||||| ||||||||||||||| ||||||||| ||| ||| |||||||||||| |
|
|
| T |
26421803 |
tttaaaattagtcattggatccactttcttgctgatttgtctcatttttgcctatgtagcagatgatgactatgcaaa |
26421726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 74 - 138
Target Start/End: Original strand, 3276363 - 3276427
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaa |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |||| ||||||| |||| |
|
|
| T |
3276363 |
tttaggctaaaatatgtttttggtccctgcaaatatagcgaatttggattttagtccctagtaaa |
3276427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 77 - 132
Target Start/End: Original strand, 16995450 - 16995505
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16995450 |
aggctaaaatatgtttttggtccctgcaaatataaagaatttgggttttggtccct |
16995505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 78 - 132
Target Start/End: Complemental strand, 20897556 - 20897502
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20897556 |
ggctaaaatatggttttggtccctgcaaatatagtgaatttgggttttggtccct |
20897502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 75 - 132
Target Start/End: Original strand, 21953203 - 21953260
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
21953203 |
ttaggctaaaatatgcttttggtccctgcaaatatagcgaatttggattttggtccct |
21953260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 76 - 214
Target Start/End: Complemental strand, 34998202 - 34998062
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct--aataaannnnnnnnagaaaatcgtccttgcaaaacattttg |
173 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||| || ||||||||||||||||| | ||| |||| | ||||||||||| ||||| |
|
|
| T |
34998202 |
taggctaaaatatgcttttgatccctgcaaatatagcgagtttgggttttggtccctggtaaaaaaaaaaatttgaaatccatccttgcaaaattttttg |
34998103 |
T |
 |
| Q |
174 |
tttttaaaaatagtccttgggcccactttcttgttgatttg |
214 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||| ||||||| |
|
|
| T |
34998102 |
tttttaaaaaaagtccttggccccactttcttgctgatttg |
34998062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 74 - 244
Target Start/End: Complemental strand, 17517372 - 17517201
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaat-aaannnnnnnnagaaaatcgtccttgcaaaacatttt |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | || |||| |||||||||||| | ||| ||| || ||| |||||| |||| |
|
|
| T |
17517372 |
tttaggctaaaatatgtttttggtccctgcaaatatggcgagtttgagttttggtccctggtaaaaaaaaaaattgaatttcatccctgcaaattttttt |
17517273 |
T |
 |
| Q |
173 |
gtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctga |
244 |
Q |
| |
|
|||||| |||||||| |||| |||||||||||| |||||||| | |||| || |||||||||| ||||||| |
|
|
| T |
17517272 |
gttttttaaaatagtacttgaacccactttcttgatgatttgttttatttttgtctatgtggcagatgctga |
17517201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 81 - 132
Target Start/End: Original strand, 20391217 - 20391268
Alignment:
| Q |
81 |
taaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20391217 |
taaaatatgcttttggtccctgcaaatatagtgaatttgggttttggtccct |
20391268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 78 - 132
Target Start/End: Original strand, 18810532 - 18810586
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
18810532 |
ggctaaaatatgattttggtccctgcaaatatagtgagtttgggttttggtccct |
18810586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 68 - 125
Target Start/End: Original strand, 1972390 - 1972447
Alignment:
| Q |
68 |
aatatctttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggtttt |
125 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
1972390 |
aatattttttggctaaaatatgtttttggtccctgcaaataaagcgaatttgggtttt |
1972447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 78 - 132
Target Start/End: Complemental strand, 1974211 - 1974157
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| ||||||| |||||||||||| |
|
|
| T |
1974211 |
ggctaaaatatgtttttgatccttgcaaatatagcgaatttgagttttggtccct |
1974157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 78 - 132
Target Start/End: Original strand, 21165246 - 21165300
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| || |||| |||||||||||| |
|
|
| T |
21165246 |
ggctaaaatatgcttttggtccctgcaaatatagcgagtttgtgttttggtccct |
21165300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 80 - 125
Target Start/End: Original strand, 20895960 - 20896005
Alignment:
| Q |
80 |
ctaaaatatgtttttggtccctgcaaatatagggaatttgggtttt |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
20895960 |
ctaaaatatgtttttggtccctgcaaatatagcgaatttgagtttt |
20896005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 76 - 128
Target Start/End: Original strand, 34995112 - 34995164
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggt |
128 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||| ||||||| |||||||| |
|
|
| T |
34995112 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttgagttttggt |
34995164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 78 - 137
Target Start/End: Complemental strand, 17000336 - 17000277
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataa |
137 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||| || ||||||||||||||||| |||| |
|
|
| T |
17000336 |
ggctaaaatatacttttggtccctgcaaatgtagtgagtttgggttttggtccctgataa |
17000277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 174 - 253
Target Start/End: Original strand, 26419609 - 26419688
Alignment:
| Q |
174 |
tttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaa |
253 |
Q |
| |
|
||||| |||||||||| ||||| |||||||||||||||||| |||||| | ||||||||| ||||||| |||||||| |
|
|
| T |
26419609 |
ttttttaaaatagtccctgggcgcactttcttgttgatttggatcattttaacttatgtggcagatgctgagtatgcaaa |
26419688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 77 - 132
Target Start/End: Original strand, 29291358 - 29291413
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||| | || ||||||||||||||||| |
|
|
| T |
29291358 |
aggctaaaatatgcttttggtccttgcaaatatggcgagtttgggttttggtccct |
29291413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 78 - 124
Target Start/End: Complemental strand, 20393327 - 20393281
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttt |
124 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
20393327 |
ggctaaaatatgcttttgatccctgcaaatatagcgaatttgggttt |
20393281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 81 - 138
Target Start/End: Complemental strand, 1171707 - 1171650
Alignment:
| Q |
81 |
taaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaa |
138 |
Q |
| |
|
||||||||||||||| |||||||||||||| || ||||| ||||||||||| ||||| |
|
|
| T |
1171707 |
taaaatatgtttttgatccctgcaaatataacgagtttggtttttggtccctgataaa |
1171650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Original strand, 1007120 - 1007155
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1007120 |
tttaggctaaaatatggttttggtccctgcaaatat |
1007155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 168 - 235
Target Start/End: Original strand, 1170530 - 1170597
Alignment:
| Q |
168 |
attttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggc |
235 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||| ||| || |||||| ||||| | | |||||||| |
|
|
| T |
1170530 |
attttgtttttaaaaatagtccttaggtccacttttttgctgttttgtcacatttttacttatgtggc |
1170597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Original strand, 6412214 - 6412249
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6412214 |
tttaggctaaaatatggttttggtccctgcaaatat |
6412249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Complemental strand, 19129524 - 19129489
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19129524 |
tttaggctaaaatatgattttggtccctgcaaatat |
19129489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Complemental strand, 19321135 - 19321100
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19321135 |
tttaggctaaaatatggttttggtccctgcaaatat |
19321100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Complemental strand, 21994407 - 21994372
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21994407 |
tttaggctaaaatatggttttggtccctgcaaatat |
21994372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Complemental strand, 22543722 - 22543687
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22543722 |
tttaggctaaaatatggttttggtccctgcaaatat |
22543687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 75 - 109
Target Start/End: Complemental strand, 18024378 - 18024344
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18024378 |
ttaggctaaaatatggttttggtccctgcaaatat |
18024344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 160 - 202
Target Start/End: Original strand, 20896030 - 20896072
Alignment:
| Q |
160 |
tgcaaaacattttgtttttaaaaatagtccttgggcccacttt |
202 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
20896030 |
tgcaaaattttttgttttttaaaatagtccttgggcccacttt |
20896072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 80 - 126
Target Start/End: Original strand, 25439650 - 25439696
Alignment:
| Q |
80 |
ctaaaatatgtttttggtccctgcaaatatagggaatttgggttttg |
126 |
Q |
| |
|
||||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
25439650 |
ctaaaatatgtttttagtccctgcaaatataacgattttgggttttg |
25439696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 1007511 - 1007478
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
1007511 |
taggctaaaatatggttttggtccctgcaaatat |
1007478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 3414385 - 3414418
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
3414385 |
taggctaaaatatggttttggtccctgcaaatat |
3414418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 3969011 - 3968978
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
3969011 |
taggctaaaatatggttttggtccctgcaaatat |
3968978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 8170153 - 8170120
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
8170153 |
taggctaaaatatggttttggtccctgcaaatat |
8170120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 8680773 - 8680806
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
8680773 |
taggctaaaatatgtttttagtccctgcaaatat |
8680806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 10910966 - 10910933
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
10910966 |
taggctaaaatatggttttggtccctgcaaatat |
10910933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 20467720 - 20467687
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
20467720 |
taggctaaaatatggttttggtccctgcaaatat |
20467687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 21147402 - 21147435
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
21147402 |
taggctaaaatatggttttggtccctgcaaatat |
21147435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 22543352 - 22543385
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
22543352 |
taggctaaaatatggttttggtccctgcaaatat |
22543385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 25137359 - 25137326
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
25137359 |
taggctaaaatatggttttggtccctgcaaatat |
25137326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 80 - 129
Target Start/End: Complemental strand, 30253596 - 30253547
Alignment:
| Q |
80 |
ctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtc |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| || || | || ||||||||| |
|
|
| T |
30253596 |
ctaaaatatgtttttggtccctgcaaatacagcgagtatgagttttggtc |
30253547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 3276355 - 3276323
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
3276355 |
aggctaaaatatggttttggtccctgcaaatat |
3276323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 3968644 - 3968676
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
3968644 |
aggctaaaatatggttttggtccctgcaaatat |
3968676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 6412580 - 6412548
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
6412580 |
aggctaaaatatggttttggtccctgcaaatat |
6412548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 12299141 - 12299109
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
12299141 |
aggctaaaatatggttttggtccctgcaaatat |
12299109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 12757609 - 12757641
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
12757609 |
aggctaaaatatggttttggtccctgcaaatat |
12757641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 13268108 - 13268140
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
13268108 |
aggctaaaatatggttttggtccctgcaaatat |
13268140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 78 - 110
Target Start/End: Original strand, 15442937 - 15442969
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatata |
110 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
15442937 |
ggctaaaatatggttttggtccctgcaaatata |
15442969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 17765008 - 17765040
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
17765008 |
aggctaaaatatggttttggtccctgcaaatat |
17765040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 17765376 - 17765344
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
17765376 |
aggctaaaatatgattttggtccctgcaaatat |
17765344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 19690392 - 19690424
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
19690392 |
aggctaaaatatggttttggtccctgcaaatat |
19690424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 21385250 - 21385282
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
21385250 |
aggctaaaatatggttttggtccctgcaaatat |
21385282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 21385585 - 21385553
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
21385585 |
aggctaaaatatggttttggtccctgcaaatat |
21385553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 23502236 - 23502268
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
23502236 |
aggctaaaatatggttttggtccctgcaaatat |
23502268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 61; Significance: 6e-26; HSPs: 73)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 148 - 236
Target Start/End: Original strand, 18326582 - 18326670
Alignment:
| Q |
148 |
gaaaatcgtccttgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggca |
236 |
Q |
| |
|
||||| ||||||||||||| | ||||||||| |||||||||| || ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18326582 |
gaaaaacgtccttgcaaaaaaatttgttttttaaaatagtccctgagcccactttcttgttgatttgtcccatttctgcctatgtggca |
18326670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 77 - 231
Target Start/End: Original strand, 10292815 - 10292969
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnnagaaaatcgtccttgcaaaacattttgttt |
176 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||| ||||||| |||||| ||| | ||||| |||| || ||| ||||||| ||||||||| |
|
|
| T |
10292815 |
aggctaaaatatgattttggtcccttcaaatatagcgaatttgcgttttgatccttgataaaaaaatttttgaaattcatccctgcaaaaaattttgttt |
10292914 |
T |
 |
| Q |
177 |
ttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatg |
231 |
Q |
| |
|
|| |||||| ||||||| ||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
10292915 |
tttaaaataatccttggatccactttcttgctgatttgtctcatttctgcgtatg |
10292969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 74 - 246
Target Start/End: Original strand, 38658477 - 38658648
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnnagaaaatcgtccttgcaaaacattttg |
173 |
Q |
| |
|
|||||||||||||||| || |||||| ||||||||||| |||||||||||||||||||| |||| |||| | ||| |||||| ||||| |
|
|
| T |
38658477 |
tttaggctaaaatatgcttctggtccatgcaaatatagcgaatttgggttttggtccctggtaaaaaaaaaattgaaatccatccctgcaaatttttttg |
38658576 |
T |
 |
| Q |
174 |
tttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgact |
246 |
Q |
| |
|
||||| ||||||||| |||| |||||||| ||| ||||||| | ||||| |||||||||||||| |||||||| |
|
|
| T |
38658577 |
ttttttaaaatagtctttggccccactttattgatgatttggcacatttatgcctatgtggcat-tgctgact |
38658648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 76 - 277
Target Start/End: Complemental strand, 45518021 - 45517820
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnnagaaaatcgtccttgcaaaacattttgtt |
175 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||| || ||||||||||||||||| | | |||| |||||||||||| ||||||| |
|
|
| T |
45518021 |
taggctaaaatatgcttttggtccctgcaagtatagcgagtttgggttttggtccctggttatttttttttttaaaaacgtccttgcaaatttttttgtt |
45517922 |
T |
 |
| Q |
176 |
tttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtggcatccaggt |
275 |
Q |
| |
|
||| ||||||||| |||||||| ||||||| | ||||| | ||||| || ||||||| | |||||||| || |||| |||| ||||||||||||||| |
|
|
| T |
45517921 |
ttttaaaatagtctatgggcccaatttcttgctaatttggcgcattttcgcttatgtggtaggtgctgactgtgtaaacttgtatatgtggcatccaggt |
45517822 |
T |
 |
| Q |
276 |
gg |
277 |
Q |
| |
|
|| |
|
|
| T |
45517821 |
gg |
45517820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 78 - 138
Target Start/End: Complemental strand, 28998052 - 28997992
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaa |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||| |||| |
|
|
| T |
28998052 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttggtccctagtaaa |
28997992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 77 - 259
Target Start/End: Complemental strand, 22534782 - 22534599
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnna-gaaaatcgtccttgcaaaacattttgtt |
175 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| || ||||||||||||||||| |||| ||| || || ||||||| ||||||| |
|
|
| T |
22534782 |
aggctaaaatatgcttttgatccctgcaaatatagcgagtttgggttttggtccctggtaaaatttttttttgaatttcaaccctgcaaaattttttgtt |
22534683 |
T |
 |
| Q |
176 |
tttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgta |
259 |
Q |
| |
|
||| |||| ||||||||| |||||||||||| ||||||| ||||||| ||| ||||||||| |||||||| | ||||| |||| |
|
|
| T |
22534682 |
ttttaaaaaagtccttggacccactttcttgctgatttggctcatttttgcttatgtggcaagtgctgactgtacaaacttgta |
22534599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 74 - 132
Target Start/End: Original strand, 10717117 - 10717175
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
10717117 |
tttaggctaaaatatgcttttggtccctgcaaatatagcgagtttgggttttggtccct |
10717175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 76 - 132
Target Start/End: Complemental strand, 10718509 - 10718453
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
10718509 |
taggctaaaatatgcttttggtccctgcaaatatagcgagtttgggttttggtccct |
10718453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 78 - 214
Target Start/End: Complemental strand, 1420501 - 1420363
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnna--gaaaatcgtccttgcaaaacattttgtt |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||| | ||||||||| ||||| | |||| || ||||| ||||| ||||||| |
|
|
| T |
1420501 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttggatattggtccctgataaaaaaaaaaaattgaaattcatcctttcaaaattttttgtt |
1420402 |
T |
 |
| Q |
176 |
tttaaaaatagtccttgggcccactttcttgttgatttg |
214 |
Q |
| |
|
||| |||||||||| ||| |||||||| ||| ||||||| |
|
|
| T |
1420401 |
ttttaaaatagtccatggacccactttattgatgatttg |
1420363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 74 - 137
Target Start/End: Original strand, 3483629 - 3483692
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataa |
137 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| || |||| |||||||||||| |||| |
|
|
| T |
3483629 |
tttagactaaaatatgtttttggtccctgcaaatatagcgagtttgagttttggtccctgataa |
3483692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 77 - 132
Target Start/End: Complemental strand, 22272330 - 22272275
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
22272330 |
aggctaaaatatgcttttggtccccgcaaatatagcgaatttgggttttggtccct |
22272275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 79 - 132
Target Start/End: Original strand, 4182623 - 4182676
Alignment:
| Q |
79 |
gctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||| |||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
4182623 |
gctaaaatatgcttttggtccctgtaaatatagcgaatttgggttttggtccct |
4182676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 77 - 138
Target Start/End: Original strand, 14197824 - 14197885
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaa |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | || ||||| |||||||||||| |||| |
|
|
| T |
14197824 |
aggctaaaatatgtttttggtccctgcaaatatggcgagtttggattttggtccctagtaaa |
14197885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 79 - 132
Target Start/End: Original strand, 28996835 - 28996888
Alignment:
| Q |
79 |
gctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
28996835 |
gctaaaatatgattttggtccctgcaaatatagtgagtttgggttttggtccct |
28996888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 77 - 269
Target Start/End: Original strand, 36588221 - 36588414
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaat-aaannnnnnnnagaaaatcgtccttgcaaaacattttgtt |
175 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| || |||| |||||||||||| | ||| ||| | ||| ||||||| ||||||| |
|
|
| T |
36588221 |
aggctaaaatatgcttttggtccctgcaaatatagcgagtttgcgttttggtccctggtaaaaaaaaaatttgaattacatccctgcaaaattttttgtt |
36588320 |
T |
 |
| Q |
176 |
tttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtggcat |
269 |
Q |
| |
|
||| ||||| |||| ||| |||||||| ||| |||||| || ||||| | | |||||| | ||||||||||||||| ||||||||||||||| |
|
|
| T |
36588321 |
ttttaaaatggtccctggacccacttttttgctgatttatcacatttttacttatgtgttagttgctgactatgcaaaaatgtacatgtggcat |
36588414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 80 - 133
Target Start/End: Original strand, 38455449 - 38455502
Alignment:
| Q |
80 |
ctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtcccta |
133 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||| ||||||||||||| |
|
|
| T |
38455449 |
ctaaaatatgtttttggtccttgcaaatatagtgaatttgagttttggtcccta |
38455502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 76 - 132
Target Start/End: Complemental strand, 38456791 - 38456735
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
38456791 |
taggctaaaatatgcttttggtccctgcaaatatagcaaatttaggttttggtccct |
38456735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 74 - 137
Target Start/End: Complemental strand, 41847243 - 41847180
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataa |
137 |
Q |
| |
|
|||||||||||||||| |||| ||| |||||||||||| ||||||| |||||||||||| |||| |
|
|
| T |
41847243 |
tttaggctaaaatatgcttttagtctctgcaaatatagcgaatttgagttttggtccctgataa |
41847180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 80 - 213
Target Start/End: Original strand, 45516399 - 45516532
Alignment:
| Q |
80 |
ctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnnagaaaatcgtccttgcaaaacattttgttttta |
179 |
Q |
| |
|
||||||||||||||| |||| || |||||||| ||||||||||||||||| || |||| ||||| | ||||||||||| |||||||||| |
|
|
| T |
45516399 |
ctaaaatatgtttttagtccatgtaaatatagcgaatttgggttttggtctctggtaaaaaaaaaattgaaaaacatccttgcaaaaatttttgtttttt |
45516498 |
T |
 |
| Q |
180 |
aaaatagtccttgggcccactttcttgttgattt |
213 |
Q |
| |
|
||||||||| ||| ||||||||||| |||||| |
|
|
| T |
45516499 |
aaaatagtctctggatccactttcttgctgattt |
45516532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 76 - 132
Target Start/End: Original strand, 1376933 - 1376989
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
1376933 |
taggcttaaatatgattttggtccctgcaaatatagccaatttggattttggtccct |
1376989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 76 - 132
Target Start/End: Complemental strand, 1385616 - 1385560
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
1385616 |
taggcttaaatatggttttggtccctgcaaatatagccaatttggattttggtccct |
1385560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 76 - 132
Target Start/End: Original strand, 22270941 - 22270997
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||| |||||||| |||| |||||| |
|
|
| T |
22270941 |
taggctaaaatatgcttttgatccctgcaaatatagcgaatttggattttagtccct |
22270997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 77 - 125
Target Start/End: Original strand, 30123151 - 30123199
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggtttt |
125 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||| ||||||||||||| |
|
|
| T |
30123151 |
aggctaaaatatgtttttggtccatacaaatatagcgaatttgggtttt |
30123199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 72 - 132
Target Start/End: Complemental strand, 30124288 - 30124228
Alignment:
| Q |
72 |
tctttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| || | |||| |||||||||||| |
|
|
| T |
30124288 |
tctttaggctaaaatatgcttttggtccctgcaaataaagcaagtttgagttttggtccct |
30124228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 77 - 132
Target Start/End: Original strand, 22533316 - 22533371
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||| |||||||||||| | |||||| || ||||||||||||||||| |
|
|
| T |
22533316 |
aggctaaaatatgcttttggtccctgtatatatagcgagtttgggttttggtccct |
22533371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 78 - 132
Target Start/End: Complemental strand, 4184038 - 4183984
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| | ||||||||||||||||| |
|
|
| T |
4184038 |
ggctaaaatatgcttttagtccctgcaaatatagtgcgtttgggttttggtccct |
4183984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 68 - 109
Target Start/End: Complemental strand, 4376020 - 4375979
Alignment:
| Q |
68 |
aatatctttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
4376020 |
aatatctttaggctaaaatatggttttagtccctgcaaatat |
4375979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 77 - 130
Target Start/End: Original strand, 6783577 - 6783630
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtcc |
130 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| | ||||||| ||||||||| |
|
|
| T |
6783577 |
aggctaaaatatgtttttggtcactgcaaatatggtgaatttgaattttggtcc |
6783630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 168 - 233
Target Start/End: Complemental strand, 10293793 - 10293728
Alignment:
| Q |
168 |
attttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtg |
233 |
Q |
| |
|
||||||||||| |||||||||||| |||| ||||||| ||||||||||||||| ||| |||||| |
|
|
| T |
10293793 |
attttgttttttaaaatagtccttaaacccattttcttgctgatttgtctcatttatgcatatgtg |
10293728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 77 - 125
Target Start/End: Complemental strand, 9465368 - 9465320
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggtttt |
125 |
Q |
| |
|
|||||||| ||||||||| || ||||||||||||| ||||||||||||| |
|
|
| T |
9465368 |
aggctaaagtatgtttttagttcctgcaaatatagtgaatttgggtttt |
9465320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 160 - 236
Target Start/End: Complemental strand, 41357342 - 41357266
Alignment:
| Q |
160 |
tgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggca |
236 |
Q |
| |
|
||||||| ||||||||||| ||||||| ||||||| ||||||||| |||||||| |||||| || ||||||||| |
|
|
| T |
41357342 |
tgcaaaaaattttgttttttgaaatagttattgggcctactttcttgatgatttgtttcatttttgaatatgtggca |
41357266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Complemental strand, 3512270 - 3512235
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3512270 |
tttaggctaaaatatggttttggtccctgcaaatat |
3512235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Original strand, 10337115 - 10337150
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10337115 |
tttaggctaaaatatggttttggtccctgcaaatat |
10337150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Complemental strand, 11019861 - 11019826
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11019861 |
tttaggctaaaatatggttttggtccctgcaaatat |
11019826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Complemental strand, 28346762 - 28346727
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28346762 |
tttaggctaaaatatggttttggtccctgcaaatat |
28346727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 79 - 138
Target Start/End: Complemental strand, 39440480 - 39440421
Alignment:
| Q |
79 |
gctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaa |
138 |
Q |
| |
|
||||||||||| ||||||||| ||||||||| | || |||| |||||||||||| ||||| |
|
|
| T |
39440480 |
gctaaaatatgcttttggtccttgcaaatatggcgagtttgagttttggtccctgataaa |
39440421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 78 - 132
Target Start/End: Complemental strand, 3031602 - 3031548
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||||||||||| |||||| | |||| ||||||||||||| |
|
|
| T |
3031602 |
ggctaaaatatgtttttggtccctgtaaatatggctcatttaggttttggtccct |
3031548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 75 - 109
Target Start/End: Complemental strand, 4710223 - 4710189
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4710223 |
ttaggctaaaatatggttttggtccctgcaaatat |
4710189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 75 - 109
Target Start/End: Complemental strand, 10337452 - 10337418
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10337452 |
ttaggctaaaatatggttttggtccctgcaaatat |
10337418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 75 - 108
Target Start/End: Original strand, 4473701 - 4473734
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaata |
108 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
4473701 |
ttaggctaaaatatggttttggtccctgcaaata |
4473734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 5357421 - 5357454
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
5357421 |
taggctaaaatatgattttggtccctgcaaatat |
5357454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 9496339 - 9496372
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
9496339 |
taggctaaaatatggttttggtccctgcaaatat |
9496372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 17073805 - 17073838
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
17073805 |
taggctaaaatatggttttggtccctgcaaatat |
17073838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 17574465 - 17574432
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
17574465 |
taggctaaaatatggttttggtccctgcaaatat |
17574432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 25600228 - 25600261
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
25600228 |
taggctaaaatatggttttggtccctgcaaatat |
25600261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 25702811 - 25702778
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
25702811 |
taggctaaaatatggttttggtccctgcaaatat |
25702778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 32726273 - 32726240
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
32726273 |
taggctaaaatatggttttggtccctgcaaatat |
32726240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 83 - 128
Target Start/End: Complemental strand, 34904563 - 34904518
Alignment:
| Q |
83 |
aaatatgtttttggtccctgcaaatatagggaatttgggttttggt |
128 |
Q |
| |
|
||||||| |||| |||||| ||||||||| |||||||||||||||| |
|
|
| T |
34904563 |
aaatatgattttagtcccttcaaatatagcgaatttgggttttggt |
34904518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 35097326 - 35097359
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
35097326 |
taggctaaaatatggttttggtccctgcaaatat |
35097359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 35347000 - 35346967
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
35347000 |
taggctaaaatatggttttggtccctgcaaatat |
35346967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 77 - 130
Target Start/End: Complemental strand, 36589447 - 36589394
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtcc |
130 |
Q |
| |
|
||||||||||||| |||| || ||||||||||||| || ||| ||||||||||| |
|
|
| T |
36589447 |
aggctaaaatatgattttagttcctgcaaatatagcgagtttaggttttggtcc |
36589394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 72 - 109
Target Start/End: Complemental strand, 37536425 - 37536388
Alignment:
| Q |
72 |
tctttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
37536425 |
tcttttggctaaaatatggttttggtccctgcaaatat |
37536388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 160 - 245
Target Start/End: Original strand, 41846729 - 41846814
Alignment:
| Q |
160 |
tgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgac |
245 |
Q |
| |
|
||||||| |||| ||||| |||||||||||| | |||||||| || | ||||||| ||||| ||||||||||| | |||||||| |
|
|
| T |
41846729 |
tgcaaaaatttttcttttttaaaatagtccttagacccacttttgtgctaatttgtcccatttttgcctatgtggtagatgctgac |
41846814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 2728231 - 2728263
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
2728231 |
aggctaaaatatgattttggtccctgcaaatat |
2728263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 7420229 - 7420261
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
7420229 |
aggctaaaatatggttttggtccctgcaaatat |
7420261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 8298976 - 8298944
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
8298976 |
aggctaaaatatggttttggtccctgcaaatat |
8298944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 9496724 - 9496692
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
9496724 |
aggctaaaatatggttttggtccctgcaaatat |
9496692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 10540783 - 10540751
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
10540783 |
aggctaaaatatggttttggtccctgcaaatat |
10540751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 11019519 - 11019551
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
11019519 |
aggctaaaatatggttttggtccctgcaaatat |
11019551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 11976372 - 11976404
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
11976372 |
aggctaaaatatggttttggtccctgcaaatat |
11976404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 20277691 - 20277723
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
20277691 |
aggctaaaatatggttttggtccctgcaaatat |
20277723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 73 - 109
Target Start/End: Complemental strand, 20278062 - 20278026
Alignment:
| Q |
73 |
ctttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
20278062 |
ctttaggctaaaatatggttttggtccctgcagatat |
20278026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 20984145 - 20984177
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
20984145 |
aggctaaaatatggttttggtccctgcaaatat |
20984177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 21064318 - 21064350
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
21064318 |
aggctaaaatatggttttggtccctgcaaatat |
21064350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 73 - 109
Target Start/End: Complemental strand, 21064689 - 21064653
Alignment:
| Q |
73 |
ctttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
21064689 |
ctttaggctaaaatatggttttggtccctgcagatat |
21064653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 27117977 - 27117945
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
27117977 |
aggctaaaatatggttttggtccctgcaaatat |
27117945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 28346393 - 28346425
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
28346393 |
aggctaaaatatggttttggtccctgcaaatat |
28346425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 28497254 - 28497286
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
28497254 |
aggctaaaatatgattttggtccctgcaaatat |
28497286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 32725906 - 32725938
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
32725906 |
aggctaaaatatggttttggtccctgcaaatat |
32725938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 34963299 - 34963331
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
34963299 |
aggctaaaatatggttttggtccctgcaaatat |
34963331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 37536085 - 37536117
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
37536085 |
aggctaaaatatggttttggtccctgcaaatat |
37536117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 39439923 - 39439955
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
39439923 |
aggctaaaatatgattttggtccctgcaaatat |
39439955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 44997930 - 44997962
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
44997930 |
aggctaaaatatgattttggtccctgcaaatat |
44997962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 59; Significance: 1e-24; HSPs: 64)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 80 - 253
Target Start/End: Complemental strand, 23863107 - 23862933
Alignment:
| Q |
80 |
ctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnnagaaaatcg-tccttgcaaaacattttgttttt |
178 |
Q |
| |
|
||||||||||||||||||| |||||||||| | || ||||||||||| |||||| |||| ||||| ||||||||||| |||||||||| |
|
|
| T |
23863107 |
ctaaaatatgtttttggtctctgcaaatatggcgagtttgggttttgatccctagtaaaaaaaaaaattgaaatccatccttgcaaaattttttgttttt |
23863008 |
T |
 |
| Q |
179 |
aaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaa |
253 |
Q |
| |
|
||||||||| |||| |||||||| ||| ||||||||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
23863007 |
caaaatagtctttggacccactttattgctgatttgtccaatttatgcctatgtggcatatgctgactgtgcaaa |
23862933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 76 - 277
Target Start/End: Original strand, 23861750 - 23861951
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnnagaaaatcgtccttgcaaaacattttgtt |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | || ||||| ||||||||||| |||| |||| | ||| ||||| ||||||| |
|
|
| T |
23861750 |
taggctaaaatatgtttttggtccctgcaaatatggagagtttggattttggtccctggtaaaaaaaaatttgaaatccatccctgcaattttttttgtt |
23861849 |
T |
 |
| Q |
176 |
tttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtggcatccaggt |
275 |
Q |
| |
|
||| |||||||||| ||| ||||||| ||||||||||| ||||| | | ||||||||| ||| ||| | ||||||||||| |||||||||||||||| |
|
|
| T |
23861850 |
ttttaaaatagtccatggatccactttattgttgatttggaccatttttacttatgtggcagatgttgattgtgcaaacatgttcatgtggcatccaggt |
23861949 |
T |
 |
| Q |
276 |
gg |
277 |
Q |
| |
|
|| |
|
|
| T |
23861950 |
gg |
23861951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 77 - 132
Target Start/End: Complemental strand, 25979311 - 25979256
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25979311 |
aggctaaaatatgtttttggtccctgcaaatatagcgaatttgggttttggtccct |
25979256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 74 - 132
Target Start/End: Original strand, 25977866 - 25977924
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
25977866 |
tttaggctaaaatatgtttttggtccctgcaaatatagtgagtttgggttttggtccct |
25977924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 76 - 132
Target Start/End: Complemental strand, 2412489 - 2412433
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||||||| |||||| |
|
|
| T |
2412489 |
taggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccct |
2412433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 77 - 132
Target Start/End: Original strand, 1777468 - 1777523
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||| |||||||||||| |
|
|
| T |
1777468 |
aggctaaaatatgtttttggtccctgcaaatatagcgagtttgagttttggtccct |
1777523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 77 - 132
Target Start/End: Original strand, 8809595 - 8809651
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccc-tgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
8809595 |
aggctaaaatatgtttttggtcccttgcaaatataacgaatttgggttttggtccct |
8809651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 75 - 138
Target Start/End: Complemental strand, 29794378 - 29794316
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaa |
138 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||| |||||||| ||| ||||| |
|
|
| T |
29794378 |
ttaggctaaaatatgtttt-ggtccctgcaaatatagcgaatttgagttttggttcctgataaa |
29794316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 160 - 246
Target Start/End: Original strand, 11087134 - 11087220
Alignment:
| Q |
160 |
tgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgact |
246 |
Q |
| |
|
||||||| |||||||||| ||||||||| | | |||||||||||| ||||||||||||||| ||||| |||||| ||||||||| |
|
|
| T |
11087134 |
tgcaaaattttttgttttttaaaatagtctcttgacccactttcttgctgatttgtctcatttttgcctgcgtggcaaatgctgact |
11087220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 78 - 132
Target Start/End: Complemental strand, 25283331 - 25283277
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||| |||||| ||||| |
|
|
| T |
25283331 |
ggctaaaatatgtttttggtcactgcaaatatagcgaatttgagttttgatccct |
25283277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 81 - 138
Target Start/End: Original strand, 43824166 - 43824223
Alignment:
| Q |
81 |
taaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaa |
138 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||| ||||||||||||| |||| |
|
|
| T |
43824166 |
taaaatatgtttttcgtccctgcaaatatagcaaatttgagttttggtccctagtaaa |
43824223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 78 - 130
Target Start/End: Complemental strand, 1778849 - 1778797
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtcc |
130 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||| || ||||||||||||||| |
|
|
| T |
1778849 |
ggctaaaatatgcttttggttcctgcaaatatagcgactttgggttttggtcc |
1778797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 81 - 133
Target Start/End: Original strand, 12067000 - 12067052
Alignment:
| Q |
81 |
taaaatatgtttttggtccctgcaaatatagggaatttgggttttggtcccta |
133 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||| ||||||||||||| |
|
|
| T |
12067000 |
taaaatatgtttttggtccctacaaatataacgaatttgagttttggtcccta |
12067052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 76 - 132
Target Start/End: Complemental strand, 36837839 - 36837783
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||| |||||||| ||||||||| |||||||||||| || ||||||||||||||||| |
|
|
| T |
36837839 |
taggttaaaatatatttttggtctctgcaaatatagcgagtttgggttttggtccct |
36837783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 81 - 132
Target Start/End: Complemental strand, 4040272 - 4040221
Alignment:
| Q |
81 |
taaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||| ||||||| ||||| |
|
|
| T |
4040272 |
taaaatatgattttggtccctgcaaatatagagaatttaggttttgctccct |
4040221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 81 - 124
Target Start/End: Complemental strand, 24754214 - 24754171
Alignment:
| Q |
81 |
taaaatatgtttttggtccctgcaaatatagggaatttgggttt |
124 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
24754214 |
taaaatatgtttttggtccctgcaaatatggcgaatttgggttt |
24754171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 78 - 128
Target Start/End: Complemental strand, 11088739 - 11088689
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggt |
128 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||| |||||||| |
|
|
| T |
11088739 |
ggctaaaatatgtttttcgtccatgcaaatatagcgaatttgagttttggt |
11088689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 74 - 108
Target Start/End: Original strand, 15531025 - 15531059
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaata |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
15531025 |
tttaggctaaaatatgtttttggtccctgcaaata |
15531059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 76 - 130
Target Start/End: Original strand, 19603736 - 19603790
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtcc |
130 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19603736 |
taggcttaaatatgtttttggtccctgcaaatataactcatttgggttttggtcc |
19603790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 78 - 132
Target Start/End: Complemental strand, 19604978 - 19604924
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||||||||||| |||||| | |||||||||||||||||| |
|
|
| T |
19604978 |
ggctaaaatatgtttttggtccctgtaaatatggctcatttgggttttggtccct |
19604924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 156 - 214
Target Start/End: Complemental strand, 24749580 - 24749522
Alignment:
| Q |
156 |
tccttgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttg |
214 |
Q |
| |
|
||||||||||| ||||||||||| |||| |||||||| |||||||||||| ||||||| |
|
|
| T |
24749580 |
tccttgcaaaaaattttgttttttaaaacggtccttggacccactttcttgctgatttg |
24749522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 160 - 253
Target Start/End: Complemental strand, 1590875 - 1590782
Alignment:
| Q |
160 |
tgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaa |
253 |
Q |
| |
|
||||||| |||||||||| |||| ||||| || ||||||||||||||||||| ||||||| || ||||||||| |||||||||| |||| |
|
|
| T |
1590875 |
tgcaaaattttttgttttttaaaaaagtccctgaatccactttcttgttgatttggctcatttttgtttatgtggcaagtgctgactatacaaa |
1590782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 80 - 125
Target Start/End: Complemental strand, 8810760 - 8810715
Alignment:
| Q |
80 |
ctaaaatatgtttttggtccctgcaaatatagggaatttgggtttt |
125 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||| |||| |
|
|
| T |
8810760 |
ctaaaatatgtttttggtctctgcaaatatagcgaatttggatttt |
8810715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 76 - 132
Target Start/End: Complemental strand, 20245367 - 20245310
Alignment:
| Q |
76 |
taggctaaaatatg-tttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||| |||||| | ||||||||||||| ||||||||||||| |||||| |
|
|
| T |
20245367 |
taggctaaaatatggtttttgattcctgcaaatatagcgaatttgggttttagtccct |
20245310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 72 - 109
Target Start/End: Complemental strand, 25705455 - 25705418
Alignment:
| Q |
72 |
tctttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25705455 |
tctttaggctaaaatatggttttggtccctgcaaatat |
25705418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 160 - 249
Target Start/End: Complemental strand, 43825904 - 43825815
Alignment:
| Q |
160 |
tgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatg |
249 |
Q |
| |
|
||||||| |||||||||| ||||||||| ||| | ||||||||| |||||||||||||| |||||| || ||| |||||||||||| |
|
|
| T |
43825904 |
tgcaaaattttttgttttttaaaatagtctctggatctactttcttgctgatttgtctcattgttgcctacgtagcagatgctgactatg |
43825815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 169 - 237
Target Start/End: Complemental strand, 3924832 - 3924764
Alignment:
| Q |
169 |
ttttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcat |
237 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| ||| ||||||| | ||||| | |||| ||||||| |
|
|
| T |
3924832 |
ttttgttttttaaaatagtccttggccccactttattgatgatttgacacatttattcctacgtggcat |
3924764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 69 - 109
Target Start/End: Original strand, 20131308 - 20131348
Alignment:
| Q |
69 |
atatctttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20131308 |
atatttttaggctaaaatatggttttggtccctgcaaatat |
20131348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Original strand, 14003405 - 14003440
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14003405 |
tttaggctaaaatatggttttggtccctgcaaatat |
14003440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Original strand, 24358612 - 24358647
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24358612 |
tttaggctaaaatatggttttggtccctgcaaatat |
24358647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 76 - 110
Target Start/End: Original strand, 10671628 - 10671662
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatata |
110 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
10671628 |
taggctaaaatatggttttggtccctgcaaatata |
10671662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 91 - 129
Target Start/End: Original strand, 12067041 - 12067079
Alignment:
| Q |
91 |
ttttggtccctgcaaatatagggaatttgggttttggtc |
129 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
12067041 |
ttttggtccctacaaatatagggaatttgagttttggtc |
12067079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 76 - 118
Target Start/End: Complemental strand, 12068406 - 12068364
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaattt |
118 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||| |||||| |
|
|
| T |
12068406 |
taggctaaaatatgcttttgatccctgcaaatatagcgaattt |
12068364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 75 - 109
Target Start/End: Complemental strand, 16673774 - 16673740
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16673774 |
ttaggctaaaatatggttttggtccctgcaaatat |
16673740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 156 - 214
Target Start/End: Original strand, 25977949 - 25978007
Alignment:
| Q |
156 |
tccttgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttg |
214 |
Q |
| |
|
||| ||||||| ||||||||||| |||| ||||| ||| |||||||||||| ||||||| |
|
|
| T |
25977949 |
tccctgcaaaaaattttgttttttaaaaaagtccctggacccactttcttgctgatttg |
25978007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 76 - 110
Target Start/End: Complemental strand, 30215873 - 30215839
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatata |
110 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
30215873 |
taggctaaaatatggttttggtccctgcaaatata |
30215839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 13215058 - 13215091
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
13215058 |
taggctaaaatatggttttggtccctgcaaatat |
13215091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 16523327 - 16523294
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
16523327 |
taggctaaaatatggttttggtccctgcaaatat |
16523294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 31909480 - 31909447
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
31909480 |
taggctaaaatatggttttggtccctgcaaatat |
31909447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 41451835 - 41451868
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
41451835 |
taggctaaaatatggttttggtccctgcaaatat |
41451868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 44559060 - 44559093
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
44559060 |
taggctaaaatatggttttggtccctgcaaatat |
44559093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 2481558 - 2481526
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
2481558 |
aggctaaaatatggttttggtccctgcaaatat |
2481526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 3172019 - 3172051
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
3172019 |
aggctaaaatatgattttggtccctgcaaatat |
3172051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 4423894 - 4423926
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
4423894 |
aggctaaaatatggttttggtccctgcaaatat |
4423926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 4424186 - 4424154
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
4424186 |
aggctaaaatatggttttggtccctgcaaatat |
4424154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 78 - 130
Target Start/End: Original strand, 11087049 - 11087101
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtcc |
130 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| || ||||| ||||||||| |
|
|
| T |
11087049 |
ggctaaaatatgattttaatccctgcaaatatagcgagtttggcttttggtcc |
11087101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 14003743 - 14003711
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
14003743 |
aggctaaaatatggttttggtccctgcaaatat |
14003711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 15842824 - 15842792
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
15842824 |
aggctaaaatatggttttggtccctgcaaatat |
15842792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 16522990 - 16523022
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
16522990 |
aggctaaaatatggttttggtccctgcaaatat |
16523022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 16673410 - 16673442
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
16673410 |
aggctaaaatatggttttggtccctgcaaatat |
16673442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 18113088 - 18113120
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
18113088 |
aggctaaaatatggttttggtccctgcaaatat |
18113120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 169 - 229
Target Start/End: Original strand, 25282498 - 25282558
Alignment:
| Q |
169 |
ttttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgccta |
229 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||| ||| ||||||| | ||||| |||||| |
|
|
| T |
25282498 |
ttttgttttttaaaatagtccttgaccccactttattgatgatttgacacatttatgccta |
25282558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 25705084 - 25705116
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
25705084 |
aggctaaaatatggttttggtccctgcaaatat |
25705116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 25954114 - 25954146
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
25954114 |
aggctaaaatatgtttttagtccctgcaaatat |
25954146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 155 - 191
Target Start/End: Original strand, 26239021 - 26239057
Alignment:
| Q |
155 |
gtccttgcaaaacattttgtttttaaaaatagtcctt |
191 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
26239021 |
gtccttgcaaaaaattttgtttttgaaaatagtcctt |
26239057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 29859873 - 29859841
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
29859873 |
aggctaaaatatggttttggtccctgcaaatat |
29859841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 30215421 - 30215453
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
30215421 |
aggctaaaatatggttttggtccctgcaaatat |
30215453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 78 - 110
Target Start/End: Complemental strand, 30844607 - 30844575
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatata |
110 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
30844607 |
ggctaaaatatgtttttggtccttgcaaatata |
30844575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 31644840 - 31644872
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
31644840 |
aggctaaaatatggttttggtccctgcaaatat |
31644872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 33576118 - 33576086
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
33576118 |
aggctaaaatatggttttggtccctgcaaatat |
33576086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 37228732 - 37228764
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
37228732 |
aggctaaaatatggttttggtccctgcaaatat |
37228764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 37911121 - 37911089
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
37911121 |
aggctaaaatatggttttggtccctgcaaatat |
37911089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 40125290 - 40125258
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
40125290 |
aggctaaaatatgattttggtccctgcaaatat |
40125258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 43672319 - 43672287
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
43672319 |
aggctaaaatatgattttggtccctgcaaatat |
43672287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 55; Significance: 2e-22; HSPs: 5)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 75 - 133
Target Start/End: Complemental strand, 345959 - 345901
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtcccta |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
345959 |
ttaggctaaaatatgtttttggtccctgcaaatatagcgaatttgggttttggtcccta |
345901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 74 - 236
Target Start/End: Complemental strand, 376432 - 376269
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaat-aaannnnnnnnagaaaatcgtccttgcaaaacatttt |
172 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| || |||||||||| ||||| || ||| |||| || | | ||||||| |||| |
|
|
| T |
376432 |
tttaggctaaaatatgcttttggtccctgcaaatatagcgagtttgggttttattccctcataaaaaaaaaaattgaaattcatgcctgcaaaatttttt |
376333 |
T |
 |
| Q |
173 |
gtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggca |
236 |
Q |
| |
|
|||||| |||||||||| ||| |||||||||| |||||||| |||||| ||| ||||||||| |
|
|
| T |
376332 |
gttttttaaaatagtccctggatccactttctttttgatttggttcatttttgcttatgtggca |
376269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #3
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 78 - 132
Target Start/End: Original strand, 374335 - 374389
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| || ||||||||||||||||| |
|
|
| T |
374335 |
ggctaaaatatgattttgatccctgcaaatatagcgagtttgggttttggtccct |
374389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #4
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 75 - 132
Target Start/End: Original strand, 344934 - 344991
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||| | || ||||||||||||||||| |
|
|
| T |
344934 |
ttaggctcaaatatgattttggtccctgcaaatatggcgagtttgggttttggtccct |
344991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #5
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 169 - 246
Target Start/End: Original strand, 345030 - 345107
Alignment:
| Q |
169 |
ttttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgact |
246 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| || ||||||| | ||||| |||||| ||||||| ||||||| |
|
|
| T |
345030 |
ttttgttttttaaaatagtccttggccccactttattaatgatttggcacatttatgcctacgtggcattcgctgact |
345107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 54; Significance: 9e-22; HSPs: 74)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 76 - 265
Target Start/End: Original strand, 45618283 - 45618472
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnnagaaaatcgtccttgcaaaacattttgtt |
175 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||| || ||||||||||||||||| |||| ||| | ||| ||||||| |||||||| |
|
|
| T |
45618283 |
taggctaatatatgcttttggtccctgcaaatatagcgagtttgggttttggtccctggtaaaaaaaaaattgaattacatccctgcaaaaaattttgtt |
45618382 |
T |
 |
| Q |
176 |
tttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtg |
265 |
Q |
| |
|
||| |||| |||||||| |||||||| ||| |||||| || ||||| | | |||||| || ||||||||||||||| ||||||||||| |
|
|
| T |
45618383 |
ttttaaaacggtccttggacccacttttttgctgatttatcacatttttacttatgtgtcagctgctgactatgcaaaaatgtacatgtg |
45618472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 78 - 229
Target Start/End: Complemental strand, 32699373 - 32699221
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaat-aaannnnnnnnagaaaatcgtccttgcaaaacattttgttt |
176 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| || ||||||||||||||||| || ||| |||| |||||| ||||||| |||| ||| |
|
|
| T |
32699373 |
ggctaaaatatgtttttggtccctgtaaatatagcgagtttgggttttggtccctcataaaaaaaaaatttgaaattcgtccctgcaaaattttttattt |
32699274 |
T |
 |
| Q |
177 |
ttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgccta |
229 |
Q |
| |
|
|| |||||||||| | |||||||||| ||| ||||||||| ||||||| |||| |
|
|
| T |
32699273 |
tttaaaatagtccctaggcccacttttttgctgatttgtcacatttctaccta |
32699221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 16 - 77
Target Start/End: Complemental strand, 25349369 - 25349308
Alignment:
| Q |
16 |
atggattaggggtcgagtcatggcccaaaataaaactaaccatagagtcatgaatatcttta |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| ||||| |
|
|
| T |
25349369 |
atggattaggggtcgagtcatggcccaaaataaaactatccatagagtcatggatagcttta |
25349308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 77 - 236
Target Start/End: Complemental strand, 3880556 - 3880397
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnnagaaaatcgtccttgcaaaacattttgttt |
176 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| || |||||||||||||||||| |||| ||| | ||| ||||||| ||||||||| |
|
|
| T |
3880556 |
aggctaaaatatgtttttggttcctgcaaatatagcgagtttgggttttggtccctagtaaaaaaaaaattgaattttatccctgcaaaaaattttgttt |
3880457 |
T |
 |
| Q |
177 |
ttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggca |
236 |
Q |
| |
|
|| |||| ||||| ||| |||| |||||| ||||||| |||||| ||| ||||||||| |
|
|
| T |
3880456 |
tttaaaaaagtccctggacccattttcttactgatttggctcattgttgcttatgtggca |
3880397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 78 - 138
Target Start/End: Original strand, 44705299 - 44705359
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaa |
138 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||| |||| |||| |
|
|
| T |
44705299 |
ggctaaaatatgtttttggtctctgcaaatatagtgaatttgggttttggttcctagtaaa |
44705359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 78 - 132
Target Start/End: Original strand, 22204055 - 22204109
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||| |||||| |
|
|
| T |
22204055 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccct |
22204109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 160 - 246
Target Start/End: Complemental strand, 29060857 - 29060771
Alignment:
| Q |
160 |
tgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgact |
246 |
Q |
| |
|
||||||| |||||||||| |||||||| | ||| |||||||||||| |||||| |||||||| |||||| |||||| ||||||||| |
|
|
| T |
29060857 |
tgcaaaattttttgttttttaaaatagttcatggacccactttcttgctgatttatctcatttttgcctacgtggcaaatgctgact |
29060771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 78 - 132
Target Start/End: Complemental strand, 42359405 - 42359351
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||| ||||||||||| |
|
|
| T |
42359405 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttggattttggtccct |
42359351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 77 - 138
Target Start/End: Complemental strand, 17326794 - 17326733
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaa |
138 |
Q |
| |
|
||||| ||||||| ||||||||||| ||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
17326794 |
aggcttaaatatggttttggtccctccaaatatagggcatttgggttttggtccctagtaaa |
17326733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 74 - 266
Target Start/End: Original strand, 19674410 - 19674602
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnnagaaaatcgtccttgcaaaacattttg |
173 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||| || |||| |||||||||||| ||| |||| || ||| ||||||| ||||| |
|
|
| T |
19674410 |
tttaggctaaaatatgcttttggtccttgcaaatatagcgagtttgagttttggtccctggtaattttttttttgaaattcatccctgcaaaattttttg |
19674509 |
T |
 |
| Q |
174 |
tttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtgg |
266 |
Q |
| |
|
||||| |||| ||||||||| |||||||| || ||||||| | ||||| |||||| ||| || || ||||| |||||| | ||||| |||| |
|
|
| T |
19674510 |
ttttttaaaaaagtccttggccccactttactgatgatttggcacatttttgcctacgtgatatttgttgactgtgcaaaaacgtacaggtgg |
19674602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 175 - 246
Target Start/End: Original strand, 29415649 - 29415720
Alignment:
| Q |
175 |
ttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgact |
246 |
Q |
| |
|
|||| |||||||||||||| ||||| |||||| ||||||||| ||||||| |||||||||| ||||||||| |
|
|
| T |
29415649 |
tttttaaaatagtccttggacccaccttcttgctgatttgtcctatttctgtctatgtggcagatgctgact |
29415720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 77 - 132
Target Start/End: Complemental strand, 33137288 - 33137233
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || |||||||||| |||||| |
|
|
| T |
33137288 |
aggctaaaatatgtttttgatccctgcaaatatagcgagtttgggttttagtccct |
33137233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 77 - 132
Target Start/End: Original strand, 42358031 - 42358086
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||| |||||| ||||| |
|
|
| T |
42358031 |
aggctaaaatatgtttttggtccctgcaaatataggaagtttgagttttgatccct |
42358086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 76 - 214
Target Start/End: Complemental strand, 54121761 - 54121622
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnnagaaaat-cgtccttgcaaaacattttgt |
174 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||| | || ||||||||||||||||| |||| | ||| | ||||||||||| ||||||| |
|
|
| T |
54121761 |
taggctaaaatatgattttgctccctgcaaatacggcgagtttgggttttggtccctggtaaaaaaaaaaaatttaattcatccttgcaaaatattttgt |
54121662 |
T |
 |
| Q |
175 |
ttttaaaaatagtccttgggcccactttcttgttgatttg |
214 |
Q |
| |
|
|||| |||||||| ||| |||||||||||||| ||||||| |
|
|
| T |
54121661 |
tttttaaaatagttcttaggcccactttcttgctgatttg |
54121622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 74 - 132
Target Start/End: Original strand, 3879082 - 3879140
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| || ||||| ||||||||||| |
|
|
| T |
3879082 |
tttaggctaaaatatgcttttgatccctgcaaatatagcgagtttggattttggtccct |
3879140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 76 - 130
Target Start/End: Original strand, 41933816 - 41933870
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtcc |
130 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||| || ||||||||||||||| |
|
|
| T |
41933816 |
taggctaaaatatgattttggtctctgcaaatatagcgagtttgggttttggtcc |
41933870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 74 - 132
Target Start/End: Complemental strand, 45619794 - 45619736
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| || ||| ||||||| ||||| |
|
|
| T |
45619794 |
tttaggctaaaatatgtttttagtccctgcaaatatagcgagtttaggttttgttccct |
45619736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 76 - 129
Target Start/End: Original strand, 35054660 - 35054713
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtc |
129 |
Q |
| |
|
|||| ||||||||| |||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
35054660 |
taggttaaaatatgattttagtccctgcaaatatagcgaatttgggttttggtc |
35054713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 78 - 138
Target Start/End: Complemental strand, 19675679 - 19675619
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaa |
138 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || ||||| ||||||||||| ||||| |
|
|
| T |
19675679 |
ggctaaaatatgcttttggtccctgcaaatataacgagtttggattttggtccctgataaa |
19675619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 81 - 129
Target Start/End: Complemental strand, 41935126 - 41935078
Alignment:
| Q |
81 |
taaaatatgtttttggtccctgcaaatatagggaatttgggttttggtc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
41935126 |
taaaatatgtttttggtccctgcaaatataacgagtttgggttttggtc |
41935078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 81 - 132
Target Start/End: Complemental strand, 16574424 - 16574373
Alignment:
| Q |
81 |
taaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||| |||||||||||| |
|
|
| T |
16574424 |
taaaatatgtttttagtccctgcaaatatagcgaatttaagttttggtccct |
16574373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 80 - 222
Target Start/End: Original strand, 16916069 - 16916212
Alignment:
| Q |
80 |
ctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtcccta-ataaannnnnnnnagaaaatcgtccttgcaaaacattttgttttt |
178 |
Q |
| |
|
||||||||| ||||||||||||||||||| | || |||| ||||||||| ||| | ||| ||||| ||||||| ||||| |||||||||| |
|
|
| T |
16916069 |
ctaaaatatacttttggtccctgcaaatatggtgagtttgagttttggtctctagagaaaaaaacttttgaaaaacgtccttacaaaaaattttgtttta |
16916168 |
T |
 |
| Q |
179 |
aaaaatagtccttgggcccactttcttgttgatttgtctcattt |
222 |
Q |
| |
|
|||| |||| |||||||||||||||| ||||||| ||||||| |
|
|
| T |
16916169 |
caaaaaagtctctgggcccactttcttgatgatttggctcattt |
16916212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 77 - 132
Target Start/End: Original strand, 17281570 - 17281625
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||| || |||| |||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
17281570 |
aggctaaaatgtgcttttagtccctgcaaatatagcgaatttggattttggtccct |
17281625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 77 - 132
Target Start/End: Original strand, 17370072 - 17370127
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||| || |||| |||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
17370072 |
aggctaaaatgtgcttttagtccctgcaaatatagcgaatttggattttggtccct |
17370127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 81 - 132
Target Start/End: Complemental strand, 17371901 - 17371850
Alignment:
| Q |
81 |
taaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||| ||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
17371901 |
taaaatatgcttttgatccctgcaaatataacgaatttgggttttggtccct |
17371850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 78 - 234
Target Start/End: Original strand, 32697999 - 32698150
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnnagaaaatcgtccttgcaaaacattttgtttt |
177 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| |||||| |||||| || ||| ||||| |||| ||| ||||||| ||||| |||| |
|
|
| T |
32697999 |
ggctaaaatatgattttgatccctgcaaatatagcgaatttaggttttagttcctgataaaaaaaattt-gaaa----tccctgcaaaaaattttatttt |
32698093 |
T |
 |
| Q |
178 |
taaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtgg |
234 |
Q |
| |
|
| ||||||||| ||||| ||||||| ||| ||||||||| ||||| ||| ||||||| |
|
|
| T |
32698094 |
ttaaaatagtcattgggtccacttttttgctgatttgtcacatttttgcttatgtgg |
32698150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 169 - 268
Target Start/End: Complemental strand, 41935036 - 41934937
Alignment:
| Q |
169 |
ttttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgtacatgtggca |
268 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| ||| ||||||| | ||||| | ||| | ||| ||||||| |||||| ||||||||||||||| |
|
|
| T |
41935036 |
ttttgttttttaaaatagtccttggacccactttgttgctgatttgacacattttagtctacatagcaattgctgaccatgcaatcatgtacatgtggca |
41934937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 77 - 246
Target Start/End: Original strand, 16573377 - 16573546
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnnagaaaatcgtccttgcaaaacattttgttt |
176 |
Q |
| |
|
||||||||||||| |||||||| || ||||||| | ||||||||||||||||| || || |||| | ||| ||||||| |||||||| |
|
|
| T |
16573377 |
aggctaaaatatgcttttggtctctacaaatatggcgaatttgggttttggtctctggtatttttttttttgaaatccatccctgcaaaattttttgttt |
16573476 |
T |
 |
| Q |
177 |
ttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgact |
246 |
Q |
| |
|
|| ||||||||| |||| |||||||| ||| ||||||| | ||||| |||||| ||||||| ||||||| |
|
|
| T |
16573477 |
tttaaaatagtctttggccccactttattgatgatttggcacatttatgcctacgtggcattcgctgact |
16573546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 160 - 245
Target Start/End: Original strand, 45533376 - 45533461
Alignment:
| Q |
160 |
tgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgac |
245 |
Q |
| |
|
||||||| |||||||||| ||||||||| || |||||||||||| | ||| ||||| ||| ||||||||||||| |||||||| |
|
|
| T |
45533376 |
tgcaaaattttttgttttttaaaatagtctctgaacccactttcttgcttattagtctcgtttatgcctatgtggcagatgctgac |
45533461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 5259211 - 5259179
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5259211 |
aggctaaaatatgtttttggtccctgcaaatat |
5259179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 74 - 110
Target Start/End: Complemental strand, 13074129 - 13074093
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatata |
110 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13074129 |
tttaggctaaaatatggttttggtccctgcaaatata |
13074093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 77 - 137
Target Start/End: Original strand, 34659705 - 34659765
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataa |
137 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| | || || ||||||||||||| |||| |
|
|
| T |
34659705 |
aggctaaaatatgcttttggtccctgcaaatatggcgagttaaggttttggtccctgataa |
34659765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 76 - 128
Target Start/End: Original strand, 38166493 - 38166545
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggt |
128 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || ||||| ||||||| |
|
|
| T |
38166493 |
taggctaaaatatgtttttaatccctgcaaatatagcgagtttggattttggt |
38166545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Original strand, 13631224 - 13631259
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13631224 |
tttaggctaaaatatggttttggtccctgcaaatat |
13631259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Complemental strand, 14488191 - 14488156
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14488191 |
tttaggctaaaatatggttttggtccctgcaaatat |
14488156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Original strand, 14594202 - 14594237
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14594202 |
tttaggctaaaatatggttttggtccctgcaaatat |
14594237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 77 - 132
Target Start/End: Original strand, 29059712 - 29059767
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||| ||| ||||||| |
|
|
| T |
29059712 |
aggctaaaatatgtttttcgtccctgcaaatataacgaatttgagttccggtccct |
29059767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Original strand, 35464014 - 35464049
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35464014 |
tttaggctaaaatatggttttggtccctgcaaatat |
35464049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 169 - 236
Target Start/End: Original strand, 41933910 - 41933977
Alignment:
| Q |
169 |
ttttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggca |
236 |
Q |
| |
|
|||||||||| ||||||||||||| | |||||||||| |||| || ||||||| ||| ||||||||| |
|
|
| T |
41933910 |
ttttgttttttaaaatagtccttgaactcactttcttgctgatgtggctcatttttgcttatgtggca |
41933977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Original strand, 42823772 - 42823807
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42823772 |
tttaggctaaaatatgattttggtccctgcaaatat |
42823807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 81 - 131
Target Start/End: Complemental strand, 38167829 - 38167779
Alignment:
| Q |
81 |
taaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccc |
131 |
Q |
| |
|
|||||||| |||||||||||| |||||||| ||||||||||||| ||||| |
|
|
| T |
38167829 |
taaaatatatttttggtccctacaaatataacgaatttgggttttagtccc |
38167779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 156 - 246
Target Start/End: Complemental strand, 45619711 - 45619621
Alignment:
| Q |
156 |
tccttgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgact |
246 |
Q |
| |
|
||||||||||| |||||||||| |||| |||| | | |||||||| ||| |||||| || |||||||||||| |||||| |||||||| |
|
|
| T |
45619711 |
tccttgcaaaagtttttgtttttttaaatggtccctagacccacttttttgctgatttatcacatttctgcctacgtggcagttgctgact |
45619621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 4211559 - 4211592
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
4211559 |
taggctaaaatatggttttggtccctgcaaatat |
4211592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 11693123 - 11693090
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
11693123 |
taggctaaaatatggttttggtccctgcaaatat |
11693090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 12152152 - 12152185
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
12152152 |
taggctaaaatatggttttggtccctgcaaatat |
12152185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 12152495 - 12152462
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
12152495 |
taggctaaaatatggttttggtccctgcaaatat |
12152462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 14487800 - 14487833
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
14487800 |
taggctaaaatatggttttggtccctgcaaatat |
14487833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 20291984 - 20292017
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
20291984 |
taggctaaaatatgattttggtccctgcaaatat |
20292017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 77 - 130
Target Start/End: Complemental strand, 29060942 - 29060889
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtcc |
130 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || |||| ||||||||| |
|
|
| T |
29060942 |
aggctaaaatatgtttttaatccctgcaaatatagcgagtttgaattttggtcc |
29060889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 29420539 - 29420506
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
29420539 |
taggctaaaatatggttttggtccctgcaaatat |
29420506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 33134889 - 33134922
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
33134889 |
taggctaaaatatgtttttgatccctgcaaatat |
33134922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 77 - 132
Target Start/End: Original strand, 40198576 - 40198628
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| || ||||||||||||||||| |
|
|
| T |
40198576 |
aggctaaaatatgctttt---ccctgcaaatatagcgagtttgggttttggtccct |
40198628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 156 - 205
Target Start/End: Original strand, 42358111 - 42358160
Alignment:
| Q |
156 |
tccttgcaaaacattttgtttttaaaaatagtccttgggcccactttctt |
205 |
Q |
| |
|
||| ||||||| |||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
42358111 |
tccctgcaaaattttttgttttttaaaatagtccttggacccactttctt |
42358160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 155 - 192
Target Start/End: Original strand, 46115492 - 46115529
Alignment:
| Q |
155 |
gtccttgcaaaacattttgtttttaaaaatagtccttg |
192 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
46115492 |
gtccttgcaaaatattttgtttttgaaaatagtccttg |
46115529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 155 - 192
Target Start/End: Original strand, 46128626 - 46128663
Alignment:
| Q |
155 |
gtccttgcaaaacattttgtttttaaaaatagtccttg |
192 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
46128626 |
gtccttgcaaaatattttgtttttgaaaatagtccttg |
46128663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 53915681 - 53915714
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
53915681 |
taggctaaaatatggttttggtccctgcaaatat |
53915714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 53916049 - 53916016
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
53916049 |
taggctaaaatatggttttggtccctgcaaatat |
53916016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 156 - 281
Target Start/End: Complemental strand, 55542559 - 55542435
Alignment:
| Q |
156 |
tccttgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaaca |
255 |
Q |
| |
|
|||||||||| |||||||||| |||| |||||| | |||||||||||||||||||| ||||||| ||| | ||| ||| ||||||| | ||||| |
|
|
| T |
55542559 |
tccttgcaaatttttttgttttttaaaaaagtcctaga-cccactttcttgttgatttgactcatttttgcttttgttgcaagtgctgaccgtacaaact |
55542461 |
T |
 |
| Q |
256 |
tgtacatgtggcatccaggtggcaat |
281 |
Q |
| |
|
|||| | ||||||| |||||||||| |
|
|
| T |
55542460 |
tgtatacatggcatctaggtggcaat |
55542435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 5827974 - 5827942
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
5827974 |
aggctaaaatatggttttggtccctgcaaatat |
5827942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 13530714 - 13530682
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
13530714 |
aggctaaaatatggttttggtccctgcaaatat |
13530682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 13631600 - 13631568
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
13631600 |
aggctaaaatatggttttggtccctgcaaatat |
13631568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 14791807 - 14791775
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
14791807 |
aggctaaaatatggttttggtccctgcaaatat |
14791775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 24774044 - 24774076
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
24774044 |
aggctaaaatatggttttggtccctgcaaatat |
24774076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 25423923 - 25423955
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
25423923 |
aggctaaaatatggttttggtccctgcaaatat |
25423955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 148 - 192
Target Start/End: Complemental strand, 25424076 - 25424032
Alignment:
| Q |
148 |
gaaaatcgtccttgcaaaacattttgtttttaaaaatagtccttg |
192 |
Q |
| |
|
|||||| |||| ||||||| ||||||||||| ||||||||||||| |
|
|
| T |
25424076 |
gaaaatagtccctgcaaaatattttgtttttgaaaatagtccttg |
25424032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 25424313 - 25424281
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
25424313 |
aggctaaaatatggttttggtccctgcaaatat |
25424281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 29499181 - 29499213
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
29499181 |
aggctaaaatatggttttggtccctgcaaatat |
29499213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 30046793 - 30046761
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
30046793 |
aggctaaaatatggttttggtccctgcaaatat |
30046761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 30061134 - 30061102
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
30061134 |
aggctaaaatatggttttggtccctgcaaatat |
30061102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 35119291 - 35119323
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
35119291 |
aggctaaaatatggttttggtccctgcaaatat |
35119323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 43231087 - 43231119
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
43231087 |
aggctaaaatatggttttggtccctgcaaatat |
43231119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 43231390 - 43231358
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
43231390 |
aggctaaaatatggttttggtccctgcaaatat |
43231358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 80 - 132
Target Start/End: Original strand, 47359516 - 47359568
Alignment:
| Q |
80 |
ctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||| || | ||||||||||| ||||||| ||||| |||||| |
|
|
| T |
47359516 |
ctaaaatatgtttttcgttcttgcaaatatagcgaatttgagttttagtccct |
47359568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 54903476 - 54903444
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
54903476 |
aggctaaaatatggttttggtccctgcaaatat |
54903444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0516 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: scaffold0516
Description:
Target: scaffold0516; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 156 - 249
Target Start/End: Complemental strand, 1115 - 1022
Alignment:
| Q |
156 |
tccttgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatg |
249 |
Q |
| |
|
||||||||||| |||||||||| ||||| |||||||| |||||||| ||| ||||||| | |||||||||||||||||||| |||||||||| |
|
|
| T |
1115 |
tccttgcaaaattttttgttttttaaaattgtccttggccccactttattgatgatttggcacatttctgcctatgtggcattcgctgactatg |
1022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0516; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 78 - 132
Target Start/End: Complemental strand, 1194 - 1140
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| | || |||| |||||||||||| |
|
|
| T |
1194 |
ggctaaaatatatttttggtctctgcaaatatggcgagtttgagttttggtccct |
1140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 4e-18; HSPs: 47)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 77 - 132
Target Start/End: Original strand, 3936577 - 3936632
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
3936577 |
aggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttggtccct |
3936632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 80 - 214
Target Start/End: Original strand, 14809165 - 14809300
Alignment:
| Q |
80 |
ctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaata-aannnnnnnnagaaaatcgtccttgcaaaacattttgttttt |
178 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||| |||||||| |||||||||||| || || |||| | ||||||||||| ||||||||||| |
|
|
| T |
14809165 |
ctaaaatatgtttttgatccctacaaatatagcgaatttggattttggtccctagtagaaataaattttgaaatccatccttgcaaaaaattttgttttt |
14809264 |
T |
 |
| Q |
179 |
aaaaatagtccttgggcccactttcttgttgatttg |
214 |
Q |
| |
|
||||||||| |||| |||||||||||| ||||||| |
|
|
| T |
14809265 |
taaaatagtcattggacccactttcttgctgatttg |
14809300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 75 - 132
Target Start/End: Original strand, 3954049 - 3954106
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
3954049 |
ttaggctaaaatatgtttttggtccttgcaaatatatcgaatttgggttttggtccct |
3954106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 75 - 128
Target Start/End: Original strand, 31540493 - 31540546
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
31540493 |
ttaggctaaaatatgtttttggtccctgcaaatataacgaatttgggttttggt |
31540546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 68 - 132
Target Start/End: Original strand, 4565383 - 4565447
Alignment:
| Q |
68 |
aatatctttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||| ||||||||| || ||||||||||||||||| |
|
|
| T |
4565383 |
aatatttttaggctaaaatatgtttttagtccctacaaatatagcgagtttgggttttggtccct |
4565447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 74 - 251
Target Start/End: Complemental strand, 15604120 - 15603944
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnnagaaaatcgtccttgcaaaacattttg |
173 |
Q |
| |
|
||||| ||||||| |||||||||||| ||||||||| | || |||||||||||||||||| |||| |||| || ||| ||||||| |||| |
|
|
| T |
15604120 |
tttagactaaaatgtgtttttggtcc-tgcaaatatggcgagtttgggttttggtccctagtaaaaaaaaaattgaaattcatccctgcaaaatttttta |
15604022 |
T |
 |
| Q |
174 |
tttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgca |
251 |
Q |
| |
|
||||| |||||||||||||| |||||||| || ||||||| | |||| ||||||||| |||| ||||||| |||| |
|
|
| T |
15604021 |
ttttttaaaatagtccttggacccactttactgatgatttggcatatttttgcctatgtagcattcgctgactgtgca |
15603944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 75 - 131
Target Start/End: Original strand, 15599762 - 15599818
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccc |
131 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||| | ||||||||||||||||||| |
|
|
| T |
15599762 |
ttaggctaaaatatgcttttggtccctacaaatatggcgaatttgggttttggtccc |
15599818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 77 - 132
Target Start/End: Complemental strand, 27571189 - 27571134
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| || ||||||||||| ||||| |
|
|
| T |
27571189 |
aggctaaaatatgattttggtccctgcaaatatagcgagtttgggttttgatccct |
27571134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 76 - 246
Target Start/End: Complemental strand, 3938121 - 3937951
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaannnnnnnnagaaaatcgtccttgcaaaacattttgtt |
175 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||| | ||| ||||||||||||| |||| ||| ||||||||||| ||||||| |
|
|
| T |
3938121 |
taggctaaaatatgcttttagtccctgcaaatatagcaagtttaggttttggtccctggtaaaaaaaaatttgaattatatccttgcaaaagtttttgtt |
3938022 |
T |
 |
| Q |
176 |
tttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgact |
246 |
Q |
| |
|
||| ||||| |||| | | |||||||| ||| ||||||||| |||||||||||| |||||| |||||||| |
|
|
| T |
3938021 |
ttttaaaatggtccctagacccacttttttgctgatttgtcacatttctgcctacgtggcaattgctgact |
3937951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 169 - 246
Target Start/End: Complemental strand, 3205071 - 3204994
Alignment:
| Q |
169 |
ttttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgact |
246 |
Q |
| |
|
|||||||||| ||||||||| |||| |||||||| ||||||||||| | ||||| |||||| ||||||| ||||||| |
|
|
| T |
3205071 |
ttttgttttttaaaatagtcattggccccactttattgttgatttggcacatttatgcctacgtggcattcgctgact |
3204994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 77 - 138
Target Start/End: Complemental strand, 34911888 - 34911827
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaa |
138 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| || ||||| ||||| |||||| |||| |
|
|
| T |
34911888 |
aggctaaaatatgattttggtccctgcaaatatagcgagtttggattttgatccctagtaaa |
34911827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 78 - 132
Target Start/End: Complemental strand, 31541681 - 31541627
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| |||||| |||||| |
|
|
| T |
31541681 |
ggctaaaatatgtttttgatccctgcaaatataacgaattttggtttttgtccct |
31541627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 78 - 246
Target Start/End: Complemental strand, 6894069 - 6893900
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaat-aaannnnnnnnagaaaatcgtccttgcaaaacattttgttt |
176 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || ||| ||||||||||||| | ||| |||| || ||| ||||||| |||||||| |
|
|
| T |
6894069 |
ggctaaaatatgtttttggtccttgcaaatatgacgagtttaggttttggtccctggtaaaaaaaaaatttgaaattcatccctgcaaaattttttgttt |
6893970 |
T |
 |
| Q |
177 |
ttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgact |
246 |
Q |
| |
|
|| ||||||||| ||| |||||||| ||| ||||||| | ||||| ||||||||| |||| ||||||| |
|
|
| T |
6893969 |
tttaaaatagtcattgaccccactttattgatgatttggcacatttatgcctatgtagcattcgctgact |
6893900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 73 - 109
Target Start/End: Complemental strand, 1105153 - 1105117
Alignment:
| Q |
73 |
ctttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1105153 |
ctttaggctaaaatatggttttggtccctgcaaatat |
1105117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Original strand, 1104854 - 1104889
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1104854 |
tttaggctaaaatatggttttggtccctgcaaatat |
1104889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Complemental strand, 19565835 - 19565800
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19565835 |
tttaggctaaaatatggttttggtccctgcaaatat |
19565800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 80 - 131
Target Start/End: Original strand, 27570058 - 27570109
Alignment:
| Q |
80 |
ctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccc |
131 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||| || ||||||||||| |||| |
|
|
| T |
27570058 |
ctaaaatatgattttggtccttgcaaatatagcgagtttgggttttgttccc |
27570109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Original strand, 32108804 - 32108839
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32108804 |
tttaggctaaaatatggttttggtccctgcaaatat |
32108839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Complemental strand, 35877056 - 35877021
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35877056 |
tttaggctaaaatatggttttggtccctgcaaatat |
35877021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 156 - 269
Target Start/End: Original strand, 3936657 - 3936770
Alignment:
| Q |
156 |
tccttgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaaca |
255 |
Q |
| |
|
||| ||||||| ||||| |||| ||||| || | ||| |||||||| ||| |||||| || ||||| | | |||||| | ||||||||||||||| | |
|
|
| T |
3936657 |
tccctgcaaaattttttgatttttaaaatggttcctggacccacttttttgctgatttatcacatttttacttatgtgttagttgctgactatgcaaaaa |
3936756 |
T |
 |
| Q |
256 |
tgtacatgtggcat |
269 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
3936757 |
tgtacatgtggcat |
3936770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 5917124 - 5917157
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
5917124 |
taggctaaaatatggttttggtccctgcaaatat |
5917157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 19685015 - 19685048
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
19685015 |
taggctaaaatatggttttggtccctgcaaatat |
19685048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 20690731 - 20690764
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
20690731 |
taggctaaaatatggttttggtccctgcaaatat |
20690764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 24443746 - 24443713
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
24443746 |
taggctaaaatatggttttggtccctgcaaatat |
24443713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 1381246 - 1381278
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
1381246 |
aggctaaaatatggttttggtccctgcaaatat |
1381278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 1381612 - 1381580
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
1381612 |
aggctaaaatatggttttggtccctgcaaatat |
1381580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 80 - 132
Target Start/End: Complemental strand, 3205159 - 3205107
Alignment:
| Q |
80 |
ctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||| ||||| ||||||||||||| || ||||||||||||||||| |
|
|
| T |
3205159 |
ctaaaatatgcttttgatccctgcaaatatgatgagtttgggttttggtccct |
3205107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 4736543 - 4736511
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
4736543 |
aggctaaaatatggttttggtccctgcaaatat |
4736511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 5917461 - 5917429
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
5917461 |
aggctaaaatatggttttggtccctgcaaatat |
5917429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 17070534 - 17070566
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
17070534 |
aggctaaaatatggttttggtccctgcaaatat |
17070566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 18258161 - 18258193
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
18258161 |
aggctaaaatatggttttggtccctgcaaatat |
18258193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 18258528 - 18258496
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
18258528 |
aggctaaaatatggttttggtccctgcaaatat |
18258496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 19565466 - 19565498
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
19565466 |
aggctaaaatatggttttggtccctgcaaatat |
19565498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 19685381 - 19685349
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
19685381 |
aggctaaaatatggttttggtccctgcaaatat |
19685349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 20660947 - 20660979
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
20660947 |
aggctaaaatatggttttggtccctgcaaatat |
20660979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 20986090 - 20986058
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
20986090 |
aggctaaaatatggttttggtccctgcaaatat |
20986058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 24443379 - 24443411
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
24443379 |
aggctaaaatatggttttggtccctgcaaatat |
24443411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 160 - 268
Target Start/End: Complemental strand, 25254107 - 25253999
Alignment:
| Q |
160 |
tgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgta |
259 |
Q |
| |
|
||||||| |||||||||| |||| |||| || | |||||||| || ||||||| | ||||| |||||| |||| || || ||||| |||||| | ||| |
|
|
| T |
25254107 |
tgcaaaattttttgttttttaaaaaagtcattagccccactttactgatgatttggcgcatttttgcctacgtggtatttgttgactgtgcaaaaacgta |
25254008 |
T |
 |
| Q |
260 |
catgtggca |
268 |
Q |
| |
|
||||||||| |
|
|
| T |
25254007 |
catgtggca |
25253999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 80 - 132
Target Start/End: Complemental strand, 25254188 - 25254136
Alignment:
| Q |
80 |
ctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||| |||||||||||||||||||| || |||| |||||| ||||| |
|
|
| T |
25254188 |
ctaaaatatgcttttggtccctgcaaatatatagagtttgagttttgatccct |
25254136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 160 - 268
Target Start/End: Complemental strand, 25317897 - 25317789
Alignment:
| Q |
160 |
tgcaaaacattttgtttttaaaaatagtccttgggcccactttcttgttgatttgtctcatttctgcctatgtggcatatgctgactatgcaaacatgta |
259 |
Q |
| |
|
||||||| |||||||||| |||| |||| || | |||||||| || ||||||| | ||||| |||||| |||| || || ||||| |||||| | ||| |
|
|
| T |
25317897 |
tgcaaaattttttgttttttaaaaaagtcattagccccactttactgatgatttggcgcatttttgcctacgtggtatttgttgactgtgcaaaaacgta |
25317798 |
T |
 |
| Q |
260 |
catgtggca |
268 |
Q |
| |
|
||||||||| |
|
|
| T |
25317797 |
catgtggca |
25317789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 80 - 132
Target Start/End: Complemental strand, 25317978 - 25317926
Alignment:
| Q |
80 |
ctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||| |||||||||||||||||||| || |||| |||||| ||||| |
|
|
| T |
25317978 |
ctaaaatatgcttttggtccctgcaaatatatagagtttgagttttgatccct |
25317926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 28213372 - 28213404
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
28213372 |
aggctaaaatatggttttggtccctgcaaatat |
28213404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 35876687 - 35876719
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
35876687 |
aggctaaaatatggttttggtccctgcaaatat |
35876719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 35928063 - 35928095
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
35928063 |
aggctaaaatatggttttggtccctgcaaatat |
35928095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Complemental strand, 37271707 - 37271675
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
37271707 |
aggctaaaatatggttttggtccctgcaaatat |
37271675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 38170513 - 38170545
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
38170513 |
aggctaaaatatggttttggtccctgcaaatat |
38170545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 40764414 - 40764446
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
40764414 |
aggctaaaatatggttttggtccctgcaaatat |
40764446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0106
Description:
Target: scaffold0106; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 76 - 132
Target Start/End: Complemental strand, 30968 - 30912
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
30968 |
taggctaaaatatggttttggtccctgcaaatatagtgagtttgggttttggtccct |
30912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106; HSP #2
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 75 - 132
Target Start/End: Original strand, 29726 - 29783
Alignment:
| Q |
75 |
ttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| | || ||||| ||||||||||| |
|
|
| T |
29726 |
ttaggctaaaatatgcttttggtccctgcaaataaaacgagtttggattttggtccct |
29783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0230 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0230
Description:
Target: scaffold0230; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 78 - 132
Target Start/End: Complemental strand, 490 - 436
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
490 |
ggctaaaatatgattttggtccctgcaaatatagtgagtttgggttttggtccct |
436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 78 - 132
Target Start/End: Original strand, 119593 - 119647
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
119593 |
ggctaaaatatgcttttggtccctgcaaatatagcgaatttgagttttggtccct |
119647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 78 - 132
Target Start/End: Complemental strand, 121044 - 120990
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
121044 |
ggctaaaatatgcttttggtccctgcaaatataacgagtttgggttttggtccct |
120990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0562 (Bit Score: 39; Significance: 0.0000000000008; HSPs: 1)
Name: scaffold0562
Description:
Target: scaffold0562; HSP #1
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 74 - 132
Target Start/End: Original strand, 9918 - 9976
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccct |
132 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| || ||||| ||||||||||| |
|
|
| T |
9918 |
tttaggctaaaatatgcttttgatccctgcaaatatagcgagtttggattttggtccct |
9976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0765 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0765
Description:
Target: scaffold0765; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 81 - 202
Target Start/End: Original strand, 1863 - 1985
Alignment:
| Q |
81 |
taaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaat-aaannnnnnnnagaaaatcgtccttgcaaaacattttgttttta |
179 |
Q |
| |
|
||||||||| ||||||||||||||||||||| || |||| |||||| |||||| | ||| |||| || ||| ||||||| |||||||||| |
|
|
| T |
1863 |
taaaatatgattttggtccctgcaaatatagcgagtttgagttttgatccctagtaaaaaaaagttttgaaattcatccatgcaaaattttttgtttttt |
1962 |
T |
 |
| Q |
180 |
aaaatagtccttgggcccacttt |
202 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
1963 |
aaaatagtccttggacccacttt |
1985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 77 - 131
Target Start/End: Original strand, 202578 - 202632
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccc |
131 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| || ||||| |||||||||| |
|
|
| T |
202578 |
aggctaaaatatgcttttggtccctgcaaatataacgagtttggattttggtccc |
202632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Complemental strand, 2664 - 2629
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2664 |
tttaggctaaaatatggttttggtccctgcaaatat |
2629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Complemental strand, 27368 - 27333
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27368 |
tttaggctaaaatatggttttggtccctgcaaatat |
27333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0095 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0095
Description:
Target: scaffold0095; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 79 - 138
Target Start/End: Complemental strand, 42813 - 42754
Alignment:
| Q |
79 |
gctaaaatatgtttttggtccctgcaaatatagggaatttgggttttggtccctaataaa |
138 |
Q |
| |
|
||||||||||| ||||||||| ||||||||| | || |||| |||||||||||| ||||| |
|
|
| T |
42813 |
gctaaaatatgcttttggtccttgcaaatatggcgagtttgagttttggtccctgataaa |
42754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Complemental strand, 75768 - 75733
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
75768 |
tttaggctaaaatatggttttggtccctgcaaatat |
75733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 74 - 109
Target Start/End: Complemental strand, 223176 - 223141
Alignment:
| Q |
74 |
tttaggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
223176 |
tttaggctaaaatatggttttggtccctgcaaatat |
223141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 47924 - 47956
Alignment:
| Q |
77 |
aggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
47924 |
aggctaaaatatggttttggtccctgcaaatat |
47956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0599 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0599
Description:
Target: scaffold0599; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 82 - 128
Target Start/End: Complemental strand, 6639 - 6593
Alignment:
| Q |
82 |
aaaatatgtttttggtccctgcaaatatagggaatttgggttttggt |
128 |
Q |
| |
|
||||| || |||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
6639 |
aaaatgtgcttttagtccctgcaaatatagcgaatttgggttttggt |
6593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Original strand, 3750 - 3783
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
3750 |
taggctaaaatatggttttggtccctgcaaatat |
3783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 30; Significance: 0.0000002; HSPs: 2)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 155 - 192
Target Start/End: Complemental strand, 82628 - 82591
Alignment:
| Q |
155 |
gtccttgcaaaacattttgtttttaaaaatagtccttg |
192 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
82628 |
gtccttgcaaaatattttgtttttgaaaatagtccttg |
82591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 82708 - 82675
Alignment:
| Q |
76 |
taggctaaaatatgtttttggtccctgcaaatat |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
82708 |
taggctaaaatatggttttggtccctgcaaatat |
82675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 78 - 110
Target Start/End: Original strand, 16724 - 16756
Alignment:
| Q |
78 |
ggctaaaatatgtttttggtccctgcaaatata |
110 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
16724 |
ggctaaaatatgattttggtccctgcaaatata |
16756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University