View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5965_low_20 (Length: 272)
Name: NF5965_low_20
Description: NF5965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5965_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 18 - 256
Target Start/End: Original strand, 699762 - 700000
Alignment:
| Q |
18 |
tataagtggcttacttattttccacctttggctgtagaggatcttaaggcatttggtttaggttgtgattggagaaggtcgtttattacgaccgatatga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
699762 |
tataagtggcttacttattttccacctttggctgtagaggatcttaaggcatttggtttaggttgtgattggagaaggtcgtttattacgaccgatatga |
699861 |
T |
 |
| Q |
118 |
acccttattttgattcttttgttaggtggcaaatgaggaaattgaagtcattggggaaggttgttaaagatgttaggtatacaattttttcgcctttgga |
217 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
699862 |
acccttattttgattctttcgttaggtggcaaatgaggaaattgaagtcattggggaaggttgttaaagatgttaggtatacaattttttcgcctttgga |
699961 |
T |
 |
| Q |
218 |
tggacaaccgtgtgctgatcatgatagggctagtggtga |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
699962 |
tggacaaccgtgtgctgatcatgatagggctagtggtga |
700000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 18 - 256
Target Start/End: Complemental strand, 23262361 - 23262123
Alignment:
| Q |
18 |
tataagtggcttacttattttccacctttggctgtagaggatcttaaggcatttggtttaggttgtgattggagaaggtcgtttattacgaccgatatga |
117 |
Q |
| |
|
||||||||| | |||||||||| || |||||||| || ||||||||||| ||||| || |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23262361 |
tataagtggttgtcttattttccgccgttggctgtcgatgatcttaaggcttttgggtttggttgtgattggagaaggtcgtttattacgacagatatga |
23262262 |
T |
 |
| Q |
118 |
acccttattttgattcttttgttaggtggcaaatgaggaaattgaagtcattggggaaggttgttaaagatgttaggtatacaattttttcgcctttgga |
217 |
Q |
| |
|
| |||||||||||| |||||||||||||||| |||||||| |||||| | | || ||||||||||| ||||||||||||||| |||||||||| ||||| |
|
|
| T |
23262261 |
atccttattttgatgcttttgttaggtggcatatgaggaagttgaaggcgtctggtaaggttgttaaggatgttaggtatacagttttttcgccattgga |
23262162 |
T |
 |
| Q |
218 |
tggacaaccgtgtgctgatcatgatagggctagtggtga |
256 |
Q |
| |
|
|||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
23262161 |
tggacagccttgtgcggatcatgatagggctagtggtga |
23262123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University