View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5965_low_27 (Length: 249)
Name: NF5965_low_27
Description: NF5965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5965_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 4 - 238
Target Start/End: Original strand, 36543941 - 36544176
Alignment:
| Q |
4 |
tatctatatgtttgtaaaaatgaattttcatgtaagttgcaattctacttaatttttcttgtttttgtcgaaggaagcaaaa-aacctttaataatatat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
36543941 |
tatctatatgtttgtaaaaatgaattttcatgtaagttgcaattctacttaatttttcttgtttttgtcgaaggaagcaaaaaaacctttaataacatat |
36544040 |
T |
|
| Q |
103 |
attttaatatcctattgagataaagtgaaatctttggtaacatgcaaatatctttaagactctttttggattaatggaaataagcagaatataaatgaac |
202 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36544041 |
attttaatacccttttgagataaagtgaaatctttggtaacatgcaaatatctttaagactctttttggattaatggaaataagcagaatataaatgatc |
36544140 |
T |
|
| Q |
203 |
gaaatggaatataacatattttgattccattatatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
36544141 |
gaaatggaatataacatattttgattccattatatt |
36544176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University