View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5967_high_14 (Length: 208)
Name: NF5967_high_14
Description: NF5967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5967_high_14 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 4 - 208
Target Start/End: Complemental strand, 48422468 - 48422263
Alignment:
| Q |
4 |
tctcttgtaggttgcagctgcgcttaaactcatgacagatcaatgattcattttccttataaattaggtagtctttttgtactcgcttgtaataggtaca |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48422468 |
tctcttgtaggttgcagctgcgcttaaactcatgacagatcaatgattcattttccttataaattaggtagtctttttgtactcgcttgtaataggtaca |
48422369 |
T |
 |
| Q |
104 |
c-ccacgtatttaaacctttttagaatgaataggattactagtagcaagattttaccacaagcaaattcagagaatcacattatcaaaatactatcaaga |
202 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48422368 |
cttcacgtatttaaacctttttagaatgaataggattactagtagcaaggttttaccacaggcaaattcagagaatcacattatcaaaatactatcaaga |
48422269 |
T |
 |
| Q |
203 |
gtctta |
208 |
Q |
| |
|
|||||| |
|
|
| T |
48422268 |
gtctta |
48422263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University