View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5967_low_8 (Length: 276)
Name: NF5967_low_8
Description: NF5967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5967_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 262
Target Start/End: Original strand, 25777523 - 25777763
Alignment:
| Q |
19 |
tgacaaggttcttcgtcaaaattacaatatagatgctctggttttcactctttaatttgcatcaactttctccgggtcaaagtgaaccttttttcacggt |
118 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25777523 |
tgacaaggttcttcatcaaaattacaatatagatgctctggttttcactcttt----tgcatcaactttctccggttcaaagtgaaccttttttcacggt |
25777618 |
T |
 |
| Q |
119 |
tttgtggagcttatg--aacacagaaacctgaaaatttgtcaacaaacagaacaaaacaagcacgcaagtaattggatgagcaacccacttgcaggatga |
216 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25777619 |
tttgtggagtttatggaaacacagaaacctgaaaatttgtcaacaa-cagaacaaaacaagcacgcaagtaattggatgagcaacccacttgcaggatga |
25777717 |
T |
 |
| Q |
217 |
atattgaagagtggcacagtgtttaaagtctcgtagtacaacaact |
262 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25777718 |
atattgaagagtggcacaatgtttaaagtctcgtagtacaacaact |
25777763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University