View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5967_low_8 (Length: 276)

Name: NF5967_low_8
Description: NF5967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5967_low_8
NF5967_low_8
[»] chr7 (1 HSPs)
chr7 (19-262)||(25777523-25777763)


Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 262
Target Start/End: Original strand, 25777523 - 25777763
Alignment:
19 tgacaaggttcttcgtcaaaattacaatatagatgctctggttttcactctttaatttgcatcaactttctccgggtcaaagtgaaccttttttcacggt 118  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||    |||||||||||||||||| ||||||||||||||||||||||||    
25777523 tgacaaggttcttcatcaaaattacaatatagatgctctggttttcactcttt----tgcatcaactttctccggttcaaagtgaaccttttttcacggt 25777618  T
119 tttgtggagcttatg--aacacagaaacctgaaaatttgtcaacaaacagaacaaaacaagcacgcaagtaattggatgagcaacccacttgcaggatga 216  Q
    ||||||||| |||||  ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
25777619 tttgtggagtttatggaaacacagaaacctgaaaatttgtcaacaa-cagaacaaaacaagcacgcaagtaattggatgagcaacccacttgcaggatga 25777717  T
217 atattgaagagtggcacagtgtttaaagtctcgtagtacaacaact 262  Q
    |||||||||||||||||| |||||||||||||||||||||||||||    
25777718 atattgaagagtggcacaatgtttaaagtctcgtagtacaacaact 25777763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University