View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5970-Insertion-10 (Length: 471)
Name: NF5970-Insertion-10
Description: NF5970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5970-Insertion-10 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 3e-58; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 309 - 471
Target Start/End: Complemental strand, 3688694 - 3688532
Alignment:
| Q |
309 |
ttccctcattcatctcactcccaaacgaaaacggtaatgatgatccataccgcaatgtttcatattgttgcggcggttgaacaacctgaaacggtgtcat |
408 |
Q |
| |
|
|||| |||||| | ||||||||||||||||| ||||| ||| ||| ||||||||| |||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
3688694 |
ttccttcattcttttcactcccaaacgaaaatggtaacgataatctataccgcaaagtttcatattgttgcggccgttgaacaacctgtaacggtgtcat |
3688595 |
T |
|
| Q |
409 |
ccaagaaacaacaccgtcaacaatctccgtcttctcccttttaaacacctgctcacattccgg |
471 |
Q |
| |
|
||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3688594 |
ccacgaaacaacaccgtcaacaatatccgtcttctcccttttaaacacctgctcacattccgg |
3688532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 235 - 312
Target Start/End: Complemental strand, 3688804 - 3688727
Alignment:
| Q |
235 |
ttcaccttcacgagaagagctttgataatcagaaatagcagaagaacacctagaagacccattagatttcacttttcc |
312 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3688804 |
ttcaccttcaggagaagagctttgataatcagaaatagcagaagaacacctagaagacccattagatttgacttttcc |
3688727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 59 - 109
Target Start/End: Complemental strand, 3688983 - 3688933
Alignment:
| Q |
59 |
tcaacaatcaaacaaataccaagaaaatgtcataatttggtttttatattt |
109 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3688983 |
tcaacaaacaaacaaataccaagaaaatgtcataatttgatttttatattt |
3688933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University