View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5970_high_26 (Length: 311)

Name: NF5970_high_26
Description: NF5970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5970_high_26
NF5970_high_26
[»] chr8 (1 HSPs)
chr8 (11-297)||(11212623-11212912)


Alignment Details
Target: chr8 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 11 - 297
Target Start/End: Complemental strand, 11212912 - 11212623
Alignment:
Q  11 caaaggtttgccataaaacgacaccgtttttagtctccagaactaaatttccattttctagaagattgagttgaggaagaggagattca---agagtgtt 107  Q
    ||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||   ||||||||    
T  11212912 caaagctttgccataaaacgacaccgtttttagtctcgagaactaaatttccattttctagaagattcagttgaggaagaggagattcatcaagagtgtt 11212813  T
Q  108 tttagtttgccataaaacggtgtcgttttgggttaagagtaattgaccggttcgagttaattgaagtgctgaaccggtgagagatgagatgggtttattc 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||||||||||||||||||||||||||     
T  11212812 tttagtttgccataaaacggtgtcgttttgggttaagagtaattgaccggttggggttaattgaagagctgaaccggtgagagatgagatgggtttatta 11212713  T
Q  208 cggtttgcgacccaaatgatgtttggagaagggagggaagtgaaacggatggaaagatagtaacgaggttgtagttggttttgttgttct 297  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11212712 cggtttgcgacccaaatgatgtttggagaagggagggaagtgaaacggatggaaagatagtaacgaggttgtagttggttttgttgttct 11212623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University