View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5970_high_34 (Length: 288)
Name: NF5970_high_34
Description: NF5970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5970_high_34 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 57 - 276
Target Start/End: Original strand, 41302108 - 41302337
Alignment:
| Q |
57 |
atatgaaatcttatatgctcattctcgacccatcgcacactaatagaataccaacacacaaatgatttactaagggttatataatcatgatgagattctt |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41302108 |
atatgaaatcttatatgctcattctcgacccatcgcacactaatagaataccaacacacaaatgatttactaagggttatataatcatgatgagactctt |
41302207 |
T |
|
| Q |
157 |
gaaagaaagaaagttccactataagaaaaacac----------ccgattactcccaaaatttaaaatatttcttttttgggaagtattaaatttattttc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41302208 |
gaaagaaagaaagttccactataagaaaaacacaactggttttccgattactcccaaaatttaaaatatttcttttttgggaagtattaaatttattttc |
41302307 |
T |
|
| Q |
247 |
ctgccctatttttctacgggttacccccta |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41302308 |
ctgccctatttttctacgggttacccccta |
41302337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 41302048 - 41302086
Alignment:
| Q |
1 |
tttatgcatcatataattggcctccaaaaatatgtatta |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41302048 |
tttatgcatcatataattggcctccaaaaatatgtatta |
41302086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University